| Variant ID: vg0205570340 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5570340 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGCTAAAACTGACTTGGAGTGTTCATTATTCATTTTTTATTTTACTAAAAAAAATGCCCGTGCGTTGCAACAGGTGAAGTCTATTTTAATCTTATTATT[G/T]
TTATATGATTTAGTTTAGATAAAATTCACTCTGGGAGTTCGCTTGGATATATATTTTTTTAGAAAATCATGAACTGCAGTTAGGAGTCCGATCATTCCAA
TTGGAATGATCGGACTCCTAACTGCAGTTCATGATTTTCTAAAAAAATATATATCCAAGCGAACTCCCAGAGTGAATTTTATCTAAACTAAATCATATAA[C/A]
AATAATAAGATTAAAATAGACTTCACCTGTTGCAACGCACGGGCATTTTTTTTAGTAAAATAAAAAATGAATAATGAACACTCCAAGTCAGTTTTAGCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 4.70% | 4.63% | 7.00% | NA |
| All Indica | 2759 | 87.90% | 0.00% | 0.22% | 11.85% | NA |
| All Japonica | 1512 | 71.50% | 14.50% | 13.89% | 0.13% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 0.00% | 0.17% | 1.68% | NA |
| Indica II | 465 | 86.50% | 0.00% | 0.22% | 13.33% | NA |
| Indica III | 913 | 82.40% | 0.00% | 0.11% | 17.52% | NA |
| Indica Intermediate | 786 | 87.40% | 0.10% | 0.38% | 12.09% | NA |
| Temperate Japonica | 767 | 56.80% | 22.00% | 21.12% | 0.00% | NA |
| Tropical Japonica | 504 | 91.50% | 4.80% | 3.57% | 0.20% | NA |
| Japonica Intermediate | 241 | 76.30% | 10.80% | 12.45% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 0.00% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205570340 | G -> T | LOC_Os02g10590.1 | upstream_gene_variant ; 539.0bp to feature; MODIFIER | silent_mutation | Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| vg0205570340 | G -> T | LOC_Os02g10600.1 | upstream_gene_variant ; 2842.0bp to feature; MODIFIER | silent_mutation | Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| vg0205570340 | G -> T | LOC_Os02g10590.2 | upstream_gene_variant ; 539.0bp to feature; MODIFIER | silent_mutation | Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| vg0205570340 | G -> T | LOC_Os02g10580.1 | downstream_gene_variant ; 2720.0bp to feature; MODIFIER | silent_mutation | Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| vg0205570340 | G -> T | LOC_Os02g10590-LOC_Os02g10600 | intergenic_region ; MODIFIER | silent_mutation | Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| vg0205570340 | G -> DEL | N | N | silent_mutation | Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205570340 | 3.97E-07 | NA | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205570340 | NA | 7.70E-06 | mr1358 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205570340 | 9.90E-06 | 3.64E-07 | mr1358 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/