\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205570340:

Variant ID: vg0205570340 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5570340
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCTAAAACTGACTTGGAGTGTTCATTATTCATTTTTTATTTTACTAAAAAAAATGCCCGTGCGTTGCAACAGGTGAAGTCTATTTTAATCTTATTATT[G/T]
TTATATGATTTAGTTTAGATAAAATTCACTCTGGGAGTTCGCTTGGATATATATTTTTTTAGAAAATCATGAACTGCAGTTAGGAGTCCGATCATTCCAA

Reverse complement sequence

TTGGAATGATCGGACTCCTAACTGCAGTTCATGATTTTCTAAAAAAATATATATCCAAGCGAACTCCCAGAGTGAATTTTATCTAAACTAAATCATATAA[C/A]
AATAATAAGATTAAAATAGACTTCACCTGTTGCAACGCACGGGCATTTTTTTTAGTAAAATAAAAAATGAATAATGAACACTCCAAGTCAGTTTTAGCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 4.70% 4.63% 7.00% NA
All Indica  2759 87.90% 0.00% 0.22% 11.85% NA
All Japonica  1512 71.50% 14.50% 13.89% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.20% 0.00% 0.17% 1.68% NA
Indica II  465 86.50% 0.00% 0.22% 13.33% NA
Indica III  913 82.40% 0.00% 0.11% 17.52% NA
Indica Intermediate  786 87.40% 0.10% 0.38% 12.09% NA
Temperate Japonica  767 56.80% 22.00% 21.12% 0.00% NA
Tropical Japonica  504 91.50% 4.80% 3.57% 0.20% NA
Japonica Intermediate  241 76.30% 10.80% 12.45% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 0.00% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205570340 G -> T LOC_Os02g10590.1 upstream_gene_variant ; 539.0bp to feature; MODIFIER silent_mutation Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0205570340 G -> T LOC_Os02g10600.1 upstream_gene_variant ; 2842.0bp to feature; MODIFIER silent_mutation Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0205570340 G -> T LOC_Os02g10590.2 upstream_gene_variant ; 539.0bp to feature; MODIFIER silent_mutation Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0205570340 G -> T LOC_Os02g10580.1 downstream_gene_variant ; 2720.0bp to feature; MODIFIER silent_mutation Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0205570340 G -> T LOC_Os02g10590-LOC_Os02g10600 intergenic_region ; MODIFIER silent_mutation Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0205570340 G -> DEL N N silent_mutation Average:47.363; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205570340 3.97E-07 NA mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205570340 NA 7.70E-06 mr1358 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205570340 9.90E-06 3.64E-07 mr1358 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251