Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205562421:

Variant ID: vg0205562421 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5562421
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, A: 0.38, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TATGCCATACTTAAAGAATATTTGATGATAAATCAAGTGATAATAAAATAAATGATAATTACATAACTTTTTTGAATAAAATGAATGGTCAAACGTTGAT[A/C]
AAAAAATCAATGGCGTCATACATTAAAATACGAAGGGAGTAGTAATTTAATGTGAAACCATTTTTTTTGGGCATAGTAGTTTGAAAAAAAAAGAAAATAT

Reverse complement sequence

ATATTTTCTTTTTTTTTCAAACTACTATGCCCAAAAAAAATGGTTTCACATTAAATTACTACTCCCTTCGTATTTTAATGTATGACGCCATTGATTTTTT[T/G]
ATCAACGTTTGACCATTCATTTTATTCAAAAAAGTTATGTAATTATCATTTATTTTATTATCACTTGATTTATCATCAAATATTCTTTAAGTATGGCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 49.00% 0.13% 0.00% NA
All Indica  2759 82.10% 17.70% 0.18% 0.00% NA
All Japonica  1512 2.80% 97.20% 0.00% 0.00% NA
Aus  269 23.00% 77.00% 0.00% 0.00% NA
Indica I  595 97.80% 1.80% 0.34% 0.00% NA
Indica II  465 66.70% 33.30% 0.00% 0.00% NA
Indica III  913 82.90% 16.90% 0.22% 0.00% NA
Indica Intermediate  786 78.50% 21.40% 0.13% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 9.10% 90.90% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 35.60% 63.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205562421 A -> C LOC_Os02g10580.1 upstream_gene_variant ; 3535.0bp to feature; MODIFIER silent_mutation Average:39.876; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0205562421 A -> C LOC_Os02g10560.1 downstream_gene_variant ; 1368.0bp to feature; MODIFIER silent_mutation Average:39.876; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0205562421 A -> C LOC_Os02g10570.1 intron_variant ; MODIFIER silent_mutation Average:39.876; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205562421 NA 6.87E-15 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 NA 1.06E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 NA 5.35E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 NA 3.15E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 NA 6.95E-08 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 NA 2.07E-15 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 NA 6.30E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 9.78E-06 5.82E-09 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 NA 4.25E-19 mr1165_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 NA 3.45E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 2.02E-06 4.00E-09 mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205562421 NA 4.48E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251