| Variant ID: vg0205559811 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5559811 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, T: 0.11, others allele: 0.00, population size: 104. )
AGATCCCGGGTGAAATAACCGGGAGTAAAAATCCATTTTTAGTCACGGTTGGTGTCATCAACCGGGACTAAAAATAGAACATTTTTAGTCCCGGTTGGTA[A/T]
CAAGATAGAGCTAGGCTAGCTAGATCCGGTTGCTCTATTATTCTATTCTTTTCTTCATTGTTTTTAATATATTGATTTCACTCCATCCCCATCCCAAAAT
ATTTTGGGATGGGGATGGAGTGAAATCAATATATTAAAAACAATGAAGAAAAGAATAGAATAATAGAGCAACCGGATCTAGCTAGCCTAGCTCTATCTTG[T/A]
TACCAACCGGGACTAAAAATGTTCTATTTTTAGTCCCGGTTGATGACACCAACCGTGACTAAAAATGGATTTTTACTCCCGGTTATTTCACCCGGGATCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 45.10% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 88.90% | 10.90% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 1.30% | 98.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 70.50% | 29.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.60% | 6.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.10% | 13.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 62.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205559811 | A -> T | LOC_Os02g10560.1 | upstream_gene_variant ; 463.0bp to feature; MODIFIER | silent_mutation | Average:38.79; most accessible tissue: Callus, score: 53.393 | N | N | N | N |
| vg0205559811 | A -> T | LOC_Os02g10550.1 | downstream_gene_variant ; 3632.0bp to feature; MODIFIER | silent_mutation | Average:38.79; most accessible tissue: Callus, score: 53.393 | N | N | N | N |
| vg0205559811 | A -> T | LOC_Os02g10570.1 | downstream_gene_variant ; 1487.0bp to feature; MODIFIER | silent_mutation | Average:38.79; most accessible tissue: Callus, score: 53.393 | N | N | N | N |
| vg0205559811 | A -> T | LOC_Os02g10550-LOC_Os02g10560 | intergenic_region ; MODIFIER | silent_mutation | Average:38.79; most accessible tissue: Callus, score: 53.393 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205559811 | NA | 3.19E-15 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205559811 | NA | 3.39E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205559811 | NA | 2.33E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205559811 | NA | 1.43E-15 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205559811 | 1.79E-06 | 5.69E-10 | mr1170 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205559811 | NA | 3.83E-15 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205559811 | NA | 4.26E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205559811 | NA | 9.07E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205559811 | NA | 1.57E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205559811 | NA | 5.27E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/