Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205541527:

Variant ID: vg0205541527 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5541527
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, C: 0.28, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCACATTCTAGTACAACGAATTTGTACAGAGGTATATATGTCTAGATTCGTTATAGTAGGATATGTCTTATCCAGTCCTAAGTTGTTATATTTTGGAA[C/T]
GAAGAGGGTATATATAGTTGCAGCCTATTTCATCTTGTGCTCAAACCAAACATGTCTACGATGCCGAGATAATCAACAAGGGGTGCTGCTACAGTAGAGA

Reverse complement sequence

TCTCTACTGTAGCAGCACCCCTTGTTGATTATCTCGGCATCGTAGACATGTTTGGTTTGAGCACAAGATGAAATAGGCTGCAACTATATATACCCTCTTC[G/A]
TTCCAAAATATAACAACTTAGGACTGGATAAGACATATCCTACTATAACGAATCTAGACATATATACCTCTGTACAAATTCGTTGTACTAGAATGTGCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	48.80%	0.19%	0.02%	NA
All Indica	2759	19.70%	80.00%	0.25%	0.04%	NA
All Japonica	1512	98.90%	1.10%	0.07%	0.00%	NA
Aus	269	81.00%	19.00%	0.00%	0.00%	NA
Indica I	595	8.20%	91.30%	0.50%	0.00%	NA
Indica II	465	33.80%	66.00%	0.22%	0.00%	NA
Indica III	913	18.20%	81.70%	0.11%	0.00%	NA
Indica Intermediate	786	21.80%	77.90%	0.25%	0.13%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	1.70%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	67.80%	31.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205541527	C -> T	LOC_Os02g10520.1	upstream_gene_variant ; 4586.0bp to feature; MODIFIER	silent_mutation	Average:69.443; most accessible tissue: Callus, score: 97.601	N	N	N	N
vg0205541527	C -> T	LOC_Os02g10520-LOC_Os02g10530	intergenic_region ; MODIFIER	silent_mutation	Average:69.443; most accessible tissue: Callus, score: 97.601	N	N	N	N
vg0205541527	C -> DEL	N	N	silent_mutation	Average:69.443; most accessible tissue: Callus, score: 97.601	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205541527	NA	6.67E-18	mr1032	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	2.96E-08	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	4.90E-18	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	1.02E-07	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	1.16E-09	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	1.33E-18	mr1478	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	1.37E-08	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	5.25E-06	mr1553	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	4.76E-13	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	1.53E-06	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	1.98E-06	mr1879	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	8.45E-21	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	1.41E-06	mr1165_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	3.08E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	8.22E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	1.16E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	6.06E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205541527	NA	2.31E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251