Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205521492:

Variant ID: vg0205521492 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5521492
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, A: 0.45, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CTAATTTCCTCCAAAATCTCTATAGGATTTTTTTTATTCTATAGGAATTTCGAAGGAAAATTTGTAGAATTCAATCCTTTGTTTTTTTTCTATAGAATTG[A/G]
AATCCTAAAACTCCTATATAACAAAAAAAAGCTTAAGAGTTTTCTAAAGAAAAATATTAGATACAGCGTGTAAAGAAAAAGAGTCTTGTACTGCTGCTGC

Reverse complement sequence

GCAGCAGCAGTACAAGACTCTTTTTCTTTACACGCTGTATCTAATATTTTTCTTTAGAAAACTCTTAAGCTTTTTTTTGTTATATAGGAGTTTTAGGATT[T/C]
CAATTCTATAGAAAAAAAACAAAGGATTGAATTCTACAAATTTTCCTTCGAAATTCCTATAGAATAAAAAAAATCCTATAGAGATTTTGGAGGAAATTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	47.10%	0.19%	0.00%	NA
All Indica	2759	85.00%	14.80%	0.29%	0.00%	NA
All Japonica	1512	1.20%	98.70%	0.07%	0.00%	NA
Aus	269	33.10%	66.90%	0.00%	0.00%	NA
Indica I	595	96.50%	3.20%	0.34%	0.00%	NA
Indica II	465	68.40%	31.40%	0.22%	0.00%	NA
Indica III	913	87.50%	12.40%	0.11%	0.00%	NA
Indica Intermediate	786	83.10%	16.40%	0.51%	0.00%	NA
Temperate Japonica	767	1.40%	98.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	8.30%	91.70%	0.00%	0.00%	NA
Intermediate	90	36.70%	63.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205521492	A -> G	LOC_Os02g10490.1	upstream_gene_variant ; 3573.0bp to feature; MODIFIER	silent_mutation	Average:57.853; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N
vg0205521492	A -> G	LOC_Os02g10500.1	upstream_gene_variant ; 1571.0bp to feature; MODIFIER	silent_mutation	Average:57.853; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N
vg0205521492	A -> G	LOC_Os02g10510.1	upstream_gene_variant ; 2495.0bp to feature; MODIFIER	silent_mutation	Average:57.853; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N
vg0205521492	A -> G	LOC_Os02g10500-LOC_Os02g10510	intergenic_region ; MODIFIER	silent_mutation	Average:57.853; most accessible tissue: Minghui63 root, score: 82.511	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205521492	NA	6.12E-17	mr1032	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	1.90E-07	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	1.35E-18	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	1.66E-16	mr1165	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	6.06E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	5.73E-11	mr1170	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	6.91E-17	mr1478	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	6.37E-07	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	7.19E-06	mr1553	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	1.52E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	1.29E-16	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	6.34E-19	mr1165_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	2.60E-08	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	8.81E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	1.31E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205521492	NA	1.05E-06	mr1548_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251