| Variant ID: vg0205521492 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5521492 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.55, A: 0.45, others allele: 0.00, population size: 103. )
CTAATTTCCTCCAAAATCTCTATAGGATTTTTTTTATTCTATAGGAATTTCGAAGGAAAATTTGTAGAATTCAATCCTTTGTTTTTTTTCTATAGAATTG[A/G]
AATCCTAAAACTCCTATATAACAAAAAAAAGCTTAAGAGTTTTCTAAAGAAAAATATTAGATACAGCGTGTAAAGAAAAAGAGTCTTGTACTGCTGCTGC
GCAGCAGCAGTACAAGACTCTTTTTCTTTACACGCTGTATCTAATATTTTTCTTTAGAAAACTCTTAAGCTTTTTTTTGTTATATAGGAGTTTTAGGATT[T/C]
CAATTCTATAGAAAAAAAACAAAGGATTGAATTCTACAAATTTTCCTTCGAAATTCCTATAGAATAAAAAAAATCCTATAGAGATTTTGGAGGAAATTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.70% | 47.10% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 85.00% | 14.80% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 1.20% | 98.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 33.10% | 66.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.50% | 3.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 68.40% | 31.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 87.50% | 12.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 83.10% | 16.40% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 63.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205521492 | A -> G | LOC_Os02g10490.1 | upstream_gene_variant ; 3573.0bp to feature; MODIFIER | silent_mutation | Average:57.853; most accessible tissue: Minghui63 root, score: 82.511 | N | N | N | N |
| vg0205521492 | A -> G | LOC_Os02g10500.1 | upstream_gene_variant ; 1571.0bp to feature; MODIFIER | silent_mutation | Average:57.853; most accessible tissue: Minghui63 root, score: 82.511 | N | N | N | N |
| vg0205521492 | A -> G | LOC_Os02g10510.1 | upstream_gene_variant ; 2495.0bp to feature; MODIFIER | silent_mutation | Average:57.853; most accessible tissue: Minghui63 root, score: 82.511 | N | N | N | N |
| vg0205521492 | A -> G | LOC_Os02g10500-LOC_Os02g10510 | intergenic_region ; MODIFIER | silent_mutation | Average:57.853; most accessible tissue: Minghui63 root, score: 82.511 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205521492 | NA | 6.12E-17 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205521492 | NA | 1.90E-07 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205521492 | NA | 1.35E-18 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205521492 | NA | 1.66E-16 | mr1165 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205521492 | NA | 6.06E-06 | mr1165 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205521492 | NA | 5.73E-11 | mr1170 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205521492 | NA | 6.91E-17 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205521492 | NA | 6.37E-07 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205521492 | NA | 7.19E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205521492 | NA | 1.52E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/