Search for Variation information by Variation ID:
Detailed information for vg0205437290:
| Variant ID: vg0205437290 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5437290 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )
Flanking Sequence (100 bp) in Reference Genome:
CGCGTTGTCGTCTGCTCCGGCAGCGTAGAGTACTGTGGAGTAGACTTGAAGGAACTCCTCTGGGCCGGTGCTCCCATCATACTTTTCTATTGCTCCAGGT[T/C]
GGAATCTCTCAGGCCATCGGACATCACGCAGGGAACGACCGAAAGCCCTACACCCAGCGTTGGGGGCGGTGGGTTGTCGGCGGTCGTGTGTCCTTCGTGG
Reverse complement sequence
CCACGAAGGACACACGACCGCCGACAACCCACCGCCCCCAACGCTGGGTGTAGGGCTTTCGGTCGTTCCCTGCGTGATGTCCGATGGCCTGAGAGATTCC[A/G]
ACCTGGAGCAATAGAAAAGTATGATGGGAGCACCGGCCCAGAGGAGTTCCTTCAAGTCTACTCCACAGTACTCTACGCTGCCGGAGCAGACGACAACGCG
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 28.00% | 1.86% | 2.07% | NA |
| All Indica | 2759 | 98.30% | 1.50% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 6.20% | 82.30% | 5.09% | 6.42% | NA |
| Aus | 269 | 98.10% | 1.50% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 2.30% | 96.30% | 0.39% | 0.91% | NA |
| Tropical Japonica | 504 | 12.10% | 64.50% | 10.32% | 13.10% | NA |
| Japonica Intermediate | 241 | 5.80% | 75.10% | 9.13% | 9.96% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 31.10% | 4.44% | 1.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205437290 | T -> DEL | LOC_Os02g10340.1 | N | frameshift_variant | Average:33.272; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| vg0205437290 | T -> C | LOC_Os02g10340.1 | missense_variant ; p.Gln305Arg; MODERATE | nonsynonymous_codon ; Q305R | Average:33.272; most accessible tissue: Minghui63 flag leaf, score: 44.406 | benign  |
-0.765 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205437290 | 2.60E-07 | 3.37E-84 | mr1134 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205437290 | NA | 1.00E-06 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205437290 | NA | 1.27E-06 | mr1504 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205437290 | NA | 4.80E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205437290 | NA | 1.59E-10 | mr1134_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205437290 | NA | 3.00E-20 | mr1276_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205437290 | NA | 2.08E-18 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205437290 | NA | 1.93E-08 | mr1672_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205437290 | NA | 9.05E-20 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205437290 | NA | 5.02E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205437290 | NA | 2.89E-11 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |