RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0205414722:

Variant ID: vg0205414722 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5414722
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

AACCGTGAAAAACCATGCAAAATTTATCAAAAATTCAAATTATTTTTTAAATTTATTTGAATTTAAGAAGGTTACCGCGGTATTTATATTACCATACACC[C/T]
GCGGTAAACCTAGTAACCGCGCGGTTACCGACGGTAAGTCGAACCCTGATTTGCACCCAGTAAAACATTTTGTTGTGTTTTTACTTTTGCTTTTACCAGA

Reverse complement sequence

TCTGGTAAAAGCAAAAGTAAAAACACAACAAAATGTTTTACTGGGTGCAAATCAGGGTTCGACTTACCGTCGGTAACCGCGCGGTTACTAGGTTTACCGC[G/A]
GGTGTATGGTAATATAAATACCGCGGTAACCTTCTTAAATTCAAATAAATTTAAAAAATAATTTGAATTTTTGATAAATTTTGCATGGTTTTTCACGGTT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.10%	44.70%	0.13%	0.11%	NA
All Indica	2759	29.70%	69.90%	0.18%	0.18%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	52.80%	46.80%	0.37%	0.00%	NA
Indica I	595	16.80%	83.00%	0.17%	0.00%	NA
Indica II	465	30.80%	68.60%	0.22%	0.43%	NA
Indica III	913	31.70%	68.30%	0.00%	0.00%	NA
Indica Intermediate	786	36.60%	62.60%	0.38%	0.38%	NA
Temperate Japonica	767	98.80%	1.20%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205414722	C -> T	LOC_Os02g10290.1	downstream_gene_variant ; 3958.0bp to feature; MODIFIER	silent_mutation	Average:73.404; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0205414722	C -> T	LOC_Os02g10300.1	downstream_gene_variant ; 431.0bp to feature; MODIFIER	silent_mutation	Average:73.404; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0205414722	C -> T	LOC_Os02g10310.1	downstream_gene_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:73.404; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0205414722	C -> T	LOC_Os02g10310.3	downstream_gene_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:73.404; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0205414722	C -> T	LOC_Os02g10310.2	downstream_gene_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:73.404; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0205414722	C -> T	LOC_Os02g10300-LOC_Os02g10310	intergenic_region ; MODIFIER	silent_mutation	Average:73.404; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg0205414722	C -> DEL	N	N	silent_mutation	Average:73.404; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N

Showing 1 to 7 of 7 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205414722	NA	1.09E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205414722	NA	3.39E-09	mr1170_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0205414722:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact