\
| Variant ID: vg0205319588 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5319588 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 120. )
CAATTATTGATTTAATGAAACTAAATTGATATTATATATATTACTATATTTATGCATAAACTTAGTTAAATTTGAAGTAGTTTGACTTTGACCAAAATCA[A/T]
AACGTCTTACAACCAGATCTGTTTAATATACTAGAGCGACAGAAGTAGCAGTATATTAGCTAGCTAGTATACTAGGTTAATATACTGCATCTGTTTCAGA
TCTGAAACAGATGCAGTATATTAACCTAGTATACTAGCTAGCTAATATACTGCTACTTCTGTCGCTCTAGTATATTAAACAGATCTGGTTGTAAGACGTT[T/A]
TGATTTTGGTCAAAGTCAAACTACTTCAAATTTAACTAAGTTTATGCATAAATATAGTAATATATATAATATCAATTTAGTTTCATTAAATCAATAATTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.40% | 43.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 81.30% | 18.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.10% | 26.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.70% | 17.80% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205319588 | A -> T | LOC_Os02g10150.1 | upstream_gene_variant ; 2194.0bp to feature; MODIFIER | silent_mutation | Average:36.497; most accessible tissue: Minghui63 root, score: 85.252 | N | N | N | N |
| vg0205319588 | A -> T | LOC_Os02g10140.1 | downstream_gene_variant ; 1567.0bp to feature; MODIFIER | silent_mutation | Average:36.497; most accessible tissue: Minghui63 root, score: 85.252 | N | N | N | N |
| vg0205319588 | A -> T | LOC_Os02g10160.1 | downstream_gene_variant ; 4944.0bp to feature; MODIFIER | silent_mutation | Average:36.497; most accessible tissue: Minghui63 root, score: 85.252 | N | N | N | N |
| vg0205319588 | A -> T | LOC_Os02g10140-LOC_Os02g10150 | intergenic_region ; MODIFIER | silent_mutation | Average:36.497; most accessible tissue: Minghui63 root, score: 85.252 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205319588 | NA | 6.05E-07 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 1.43E-06 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 4.24E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 5.73E-09 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 1.75E-06 | mr1052 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 5.49E-07 | mr1536 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 1.30E-10 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 7.08E-15 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 7.29E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 1.80E-06 | mr1006_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 3.88E-09 | mr1051_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 6.60E-08 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 7.53E-11 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205319588 | NA | 2.69E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |