\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205293173:

Variant ID: vg0205293173 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5293173
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:


TTTCATTAAATCGGTGAACCATTAATTTTAACCATTAGATCTATCTAAAATACAAAATTCCGGTAGCCAGCACGTACTCCCTCCCTCTAGCCACCCCCAA[C/T]
TCTTCCCTTCTCCCTTATTTCTAGCTAACATAGATCTATCTTAAGATTTTGAAATTACGCTCATCTGGAAAAAGAATCACTTGTAGAAAAAGTCCTCCAA

Reverse complement sequence

TTGGAGGACTTTTTCTACAAGTGATTCTTTTTCCAGATGAGCGTAATTTCAAAATCTTAAGATAGATCTATGTTAGCTAGAAATAAGGGAGAAGGGAAGA[G/A]
TTGGGGGTGGCTAGAGGGAGGGAGTACGTGCTGGCTACCGGAATTTTGTATTTTAGATAGATCTAATGGTTAAAATTAATGGTTCACCGATTTAATGAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 6.00% 0.93% 0.00% NA
All Indica  2759 88.40% 10.20% 1.41% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.20% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 69.10% 26.60% 4.37% 0.00% NA
Indica II  465 94.40% 4.30% 1.29% 0.00% NA
Indica III  913 95.70% 4.10% 0.22% 0.00% NA
Indica Intermediate  786 90.80% 8.50% 0.64% 0.00% NA
Temperate Japonica  767 99.50% 0.10% 0.39% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205293173 C -> T LOC_Os02g10130.1 downstream_gene_variant ; 4471.0bp to feature; MODIFIER silent_mutation Average:43.52; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0205293173 C -> T LOC_Os02g10120-LOC_Os02g10130 intergenic_region ; MODIFIER silent_mutation Average:43.52; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205293173 4.33E-08 2.55E-08 mr1633 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 1.35E-08 5.23E-10 mr1633 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 2.18E-06 NA mr1636 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 4.10E-06 2.66E-06 mr1636 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 7.67E-06 3.21E-07 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 4.83E-06 9.29E-08 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 NA 3.81E-06 mr1767 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 2.10E-06 NA mr1838 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 1.85E-06 1.22E-08 mr1838 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 NA 6.13E-08 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 6.23E-11 NA mr1909 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 2.13E-11 8.30E-13 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 5.47E-09 NA mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 6.70E-10 4.78E-11 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 2.13E-09 1.28E-09 mr1633_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 2.09E-09 5.82E-10 mr1633_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 NA 3.95E-07 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 3.98E-06 NA mr1641_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 1.07E-07 2.02E-10 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 NA 2.41E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 NA 4.42E-07 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 NA 4.90E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 NA 2.00E-07 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 NA 1.26E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205293173 2.70E-06 3.82E-07 mr1921_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251