\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205287313:

Variant ID: vg0205287313 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5287313
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, T: 0.26, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GATATGTAAGTTTTTCCTTTTTCTTCAAAAAGAGAGAGAATAAAGATAAAATTATGCGAACTACGGTAGCTCAACTCTAGAATTAAGAAAATTCTAGTTC[T/C]
GCGAAGGATGAAGAGAGAAGGCAATGGAAAGAAGAGGTCCGATATAGCATAACACAAGCGACAAGGCAAAGAGGTATTTTAGAAGAATCATTTTTTCTTC

Reverse complement sequence

GAAGAAAAAATGATTCTTCTAAAATACCTCTTTGCCTTGTCGCTTGTGTTATGCTATATCGGACCTCTTCTTTCCATTGCCTTCTCTCTTCATCCTTCGC[A/G]
GAACTAGAATTTTCTTAATTCTAGAGTTGAGCTACCGTAGTTCGCATAATTTTATCTTTATTCTCTCTCTTTTTGAAGAAAAAGGAAAAACTTACATATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 42.80% 0.08% 0.00% NA
All Indica  2759 82.60% 17.20% 0.14% 0.00% NA
All Japonica  1512 2.00% 98.00% 0.00% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 56.80% 42.90% 0.34% 0.00% NA
Indica II  465 92.00% 8.00% 0.00% 0.00% NA
Indica III  913 91.50% 8.40% 0.11% 0.00% NA
Indica Intermediate  786 86.40% 13.50% 0.13% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205287313 T -> C LOC_Os02g10120.1 upstream_gene_variant ; 4687.0bp to feature; MODIFIER silent_mutation Average:50.711; most accessible tissue: Callus, score: 72.736 N N N N
vg0205287313 T -> C LOC_Os02g10120-LOC_Os02g10130 intergenic_region ; MODIFIER silent_mutation Average:50.711; most accessible tissue: Callus, score: 72.736 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205287313 NA 1.66E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 8.31E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 6.22E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 3.28E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 1.37E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 2.66E-07 2.94E-41 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 1.68E-06 mr1480 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 4.56E-12 1.70E-16 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 2.24E-11 1.67E-14 mr1633 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 3.84E-08 1.42E-20 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 2.44E-07 6.88E-09 mr1636 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 2.64E-09 5.74E-25 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.50E-07 1.92E-10 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 5.55E-07 1.48E-17 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.60E-06 1.42E-07 mr1683 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 4.44E-11 2.84E-58 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 2.19E-09 3.06E-13 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 2.95E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 8.16E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 2.45E-23 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 2.73E-09 2.07E-28 mr1767 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.54E-08 1.80E-10 mr1767 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 3.12E-11 2.13E-36 mr1838 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 7.87E-08 1.95E-12 mr1838 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.17E-09 2.08E-36 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 5.48E-08 1.22E-13 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 2.51E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 1.15E-06 mr1906 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.25E-17 8.55E-38 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 6.05E-16 1.71E-21 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.22E-14 2.97E-29 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 3.60E-15 1.58E-20 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 2.31E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 3.34E-19 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 2.12E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 1.15E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 4.73E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 1.19E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 6.88E-07 NA mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 1.50E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 4.17E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.67E-12 1.82E-13 mr1633_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 4.37E-10 2.67E-11 mr1633_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.80E-08 1.39E-22 mr1636_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 5.39E-07 8.80E-11 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.60E-10 8.61E-26 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 4.03E-09 6.50E-14 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 7.00E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 1.26E-11 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.06E-06 4.65E-10 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 5.50E-08 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 1.98E-18 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 5.03E-09 1.00E-26 mr1767_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 7.11E-07 4.89E-10 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.31E-07 1.86E-24 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 6.72E-07 9.48E-12 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 6.98E-11 9.42E-19 mr1909_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 2.31E-08 9.21E-11 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.51E-10 6.04E-18 mr1921_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 1.74E-08 2.69E-10 mr1921_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205287313 NA 1.03E-23 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251