\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205285361:

Variant ID: vg0205285361 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5285361
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATAACACTATTTTCCGCCACTATAATTAACTACTCCCTCCATTCCAAATTGATGTACATATTTCATAGATACACTAAAACCAAAAAAACTAATAACTCT[C/T]
TCATACTATATTTACTTTAGCAACAAACTCGATGCATGCACCATCCCCACTATTTCCTAGCCAATAGCAAATCAAGATATTGCATGTGGGTTATAAATAT

Reverse complement sequence

ATATTTATAACCCACATGCAATATCTTGATTTGCTATTGGCTAGGAAATAGTGGGGATGGTGCATGCATCGAGTTTGTTGCTAAAGTAAATATAGTATGA[G/A]
AGAGTTATTAGTTTTTTTGGTTTTAGTGTATCTATGAAATATGTACATCAATTTGGAATGGAGGGAGTAGTTAATTATAGTGGCGGAAAATAGTGTTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.40% 0.04% 0.00% NA
All Indica  2759 87.40% 12.50% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 87.50% 12.50% 0.00% 0.00% NA
Indica III  913 79.20% 20.60% 0.22% 0.00% NA
Indica Intermediate  786 87.40% 12.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205285361 C -> T LOC_Os02g10120.1 upstream_gene_variant ; 2735.0bp to feature; MODIFIER silent_mutation Average:36.235; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N
vg0205285361 C -> T LOC_Os02g10120-LOC_Os02g10130 intergenic_region ; MODIFIER silent_mutation Average:36.235; most accessible tissue: Minghui63 flag leaf, score: 59.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205285361 NA 3.30E-07 mr1036_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205285361 7.55E-06 6.83E-08 mr1036_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205285361 NA 2.01E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205285361 NA 2.62E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205285361 1.26E-06 7.64E-09 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205285361 NA 5.74E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205285361 NA 1.22E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205285361 NA 1.36E-10 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251