\
| Variant ID: vg0205284069 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5284069 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 127. )
TAAAATGGTTGAAATAAGAAAAAACTAATGCGTATGAAGCAAAAAAAAAACTTTTGTAATACGTAATCTTTTTTAGTATTTATAAATTTTTGCATTAAAA[A/G]
CAAGATTAAATTAATTTCAACTTTGTATATCACAAAACTATATATTTAAAAATTTGTATCACAAAAATTATGGATTTAACATAATTTTCATTTACAAAAT
ATTTTGTAAATGAAAATTATGTTAAATCCATAATTTTTGTGATACAAATTTTTAAATATATAGTTTTGTGATATACAAAGTTGAAATTAATTTAATCTTG[T/C]
TTTTAATGCAAAAATTTATAAATACTAAAAAAGATTACGTATTACAAAAGTTTTTTTTTTGCTTCATACGCATTAGTTTTTTCTTATTTCAACCATTTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.10% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 88.30% | 10.40% | 1.34% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 68.40% | 26.90% | 4.71% | 0.00% | NA |
| Indica II | 465 | 94.40% | 4.50% | 1.08% | 0.00% | NA |
| Indica III | 913 | 95.70% | 4.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 91.00% | 8.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.10% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205284069 | A -> G | LOC_Os02g10120.1 | upstream_gene_variant ; 1443.0bp to feature; MODIFIER | silent_mutation | Average:40.214; most accessible tissue: Minghui63 flag leaf, score: 82.289 | N | N | N | N |
| vg0205284069 | A -> G | LOC_Os02g10120-LOC_Os02g10130 | intergenic_region ; MODIFIER | silent_mutation | Average:40.214; most accessible tissue: Minghui63 flag leaf, score: 82.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205284069 | NA | 5.50E-07 | mr1274 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 7.86E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | 2.17E-06 | 5.00E-07 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | 9.78E-07 | 1.73E-08 | mr1633 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 8.63E-06 | mr1636 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 5.25E-06 | mr1641 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 6.18E-06 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 1.70E-06 | mr1767 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 2.70E-07 | mr1838 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 2.37E-08 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | 7.43E-10 | NA | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | 1.97E-10 | 1.52E-13 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | 2.79E-09 | NA | mr1921 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | 2.54E-10 | 6.07E-13 | mr1921 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | 1.63E-07 | 6.02E-08 | mr1633_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | 4.35E-07 | 9.59E-08 | mr1633_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 3.02E-07 | mr1636_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | 8.42E-06 | 7.12E-09 | mr1641_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 2.00E-06 | mr1706_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 6.09E-07 | mr1706_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 1.67E-07 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 9.41E-06 | mr1909_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205284069 | NA | 2.19E-06 | mr1921_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |