\
| Variant ID: vg0205136369 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5136369 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )
CGTCGCGCGAAGCATATCGAGATTGACATTCACTTTGTTTCTGAGAAGGTTGCTTTGGGGCAGGTTCATGTGCTACATGTCCTGTCTTCTCACCAGTTTG[C/T]
GTACATCATGACCAAAAGCCTACCTATTTAGTTATTTACTGATTTTAGGTCGAGTCTTTGCGTTTGTGATCCTCCCGTTGCAAATGCGGGCGGGTATTGG
CCAATACCCGCCCGCATTTGCAACGGGAGGATCACAAACGCAAAGACTCGACCTAAAATCAGTAAATAACTAAATAGGTAGGCTTTTGGTCATGATGTAC[G/A]
CAAACTGGTGAGAAGACAGGACATGTAGCACATGAACCTGCCCCAAAGCAACCTTCTCAGAAACAAAGTGAATGTCAATCTCGATATGCTTCGCGCGACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.20% | 3.00% | 1.82% | 0.00% | NA |
| All Indica | 2759 | 92.00% | 5.00% | 3.01% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.00% | 8.70% | 7.23% | 0.00% | NA |
| Indica II | 465 | 88.60% | 10.30% | 1.08% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.80% | 4.70% | 4.45% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205136369 | C -> T | LOC_Os02g09910.1 | downstream_gene_variant ; 3740.0bp to feature; MODIFIER | silent_mutation | Average:51.179; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| vg0205136369 | C -> T | LOC_Os02g09910-LOC_Os02g09920 | intergenic_region ; MODIFIER | silent_mutation | Average:51.179; most accessible tissue: Minghui63 flag leaf, score: 65.44 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205136369 | NA | 7.90E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205136369 | NA | 2.15E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205136369 | NA | 4.55E-10 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205136369 | NA | 2.49E-08 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205136369 | NA | 4.20E-06 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205136369 | NA | 7.00E-09 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205136369 | NA | 1.26E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205136369 | 9.60E-06 | 9.63E-06 | mr1273_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205136369 | 1.05E-06 | 1.05E-06 | mr1273_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205136369 | NA | 1.58E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205136369 | NA | 8.78E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |