\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205099249:

Variant ID: vg0205099249 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5099249
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.41, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGCGCTTCCCAAAAACCTTATTGCCGCCTTCTCCCGGTGCAGGACGTCGAAGGCAGAGGTTCCGGAGACTTGCTCTACCGATCGCCGGTGCACGCCGG[T/C]
GAGCGGGATGGAGTAGTCTACGAGCGATGGCGCAGCACAGAGTAGGAGGCAAACCCTAGATTGATTTCGCGTGTGTTGCGTGAAGGTGGCGGCTCGGTTT

Reverse complement sequence

AAACCGAGCCGCCACCTTCACGCAACACACGCGAAATCAATCTAGGGTTTGCCTCCTACTCTGTGCTGCGCCATCGCTCGTAGACTACTCCATCCCGCTC[A/G]
CCGGCGTGCACCGGCGATCGGTAGAGCAAGTCTCCGGAACCTCTGCCTTCGACGTCCTGCACCGGGAGAAGGCGGCAATAAGGTTTTTGGGAAGCGCTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.30% 45.20% 7.49% 0.00% NA
All Indica  2759 71.20% 20.50% 8.26% 0.00% NA
All Japonica  1512 0.90% 98.90% 0.13% 0.00% NA
Aus  269 66.90% 7.80% 25.28% 0.00% NA
Indica I  595 60.50% 39.00% 0.50% 0.00% NA
Indica II  465 62.80% 14.60% 22.58% 0.00% NA
Indica III  913 83.60% 11.00% 5.48% 0.00% NA
Indica Intermediate  786 70.00% 21.10% 8.91% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 0.20% 99.60% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 96.70% 0.41% 0.00% NA
VI/Aromatic  96 45.80% 7.30% 46.88% 0.00% NA
Intermediate  90 36.70% 51.10% 12.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205099249 T -> C LOC_Os02g09870.1 upstream_gene_variant ; 418.0bp to feature; MODIFIER silent_mutation Average:54.507; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N
vg0205099249 T -> C LOC_Os02g09870-LOC_Os02g09880 intergenic_region ; MODIFIER silent_mutation Average:54.507; most accessible tissue: Zhenshan97 flag leaf, score: 78.512 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205099249 NA 5.75E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 5.25E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 1.83E-08 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 4.62E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 2.34E-16 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 6.36E-06 NA mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 1.24E-17 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 1.85E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 8.27E-15 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 3.42E-06 2.51E-07 mr1921 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 6.74E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 7.39E-12 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 7.53E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249 NA 1.15E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251