Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205099249:

Variant ID: vg0205099249 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5099249
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.59, T: 0.41, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGCGCTTCCCAAAAACCTTATTGCCGCCTTCTCCCGGTGCAGGACGTCGAAGGCAGAGGTTCCGGAGACTTGCTCTACCGATCGCCGGTGCACGCCGG[T/C]
GAGCGGGATGGAGTAGTCTACGAGCGATGGCGCAGCACAGAGTAGGAGGCAAACCCTAGATTGATTTCGCGTGTGTTGCGTGAAGGTGGCGGCTCGGTTT

Reverse complement sequence

AAACCGAGCCGCCACCTTCACGCAACACACGCGAAATCAATCTAGGGTTTGCCTCCTACTCTGTGCTGCGCCATCGCTCGTAGACTACTCCATCCCGCTC[A/G]
CCGGCGTGCACCGGCGATCGGTAGAGCAAGTCTCCGGAACCTCTGCCTTCGACGTCCTGCACCGGGAGAAGGCGGCAATAAGGTTTTTGGGAAGCGCTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.30%	45.20%	7.49%	0.00%	NA
All Indica	2759	71.20%	20.50%	8.26%	0.00%	NA
All Japonica	1512	0.90%	98.90%	0.13%	0.00%	NA
Aus	269	66.90%	7.80%	25.28%	0.00%	NA
Indica I	595	60.50%	39.00%	0.50%	0.00%	NA
Indica II	465	62.80%	14.60%	22.58%	0.00%	NA
Indica III	913	83.60%	11.00%	5.48%	0.00%	NA
Indica Intermediate	786	70.00%	21.10%	8.91%	0.00%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	0.20%	99.60%	0.20%	0.00%	NA
Japonica Intermediate	241	2.90%	96.70%	0.41%	0.00%	NA
VI/Aromatic	96	45.80%	7.30%	46.88%	0.00%	NA
Intermediate	90	36.70%	51.10%	12.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205099249	T -> C	LOC_Os02g09870.1	upstream_gene_variant ; 418.0bp to feature; MODIFIER	silent_mutation	Average:54.507; most accessible tissue: Zhenshan97 flag leaf, score: 78.512	N	N	N	N
vg0205099249	T -> C	LOC_Os02g09870-LOC_Os02g09880	intergenic_region ; MODIFIER	silent_mutation	Average:54.507; most accessible tissue: Zhenshan97 flag leaf, score: 78.512	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205099249	NA	5.75E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	5.25E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	1.83E-08	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	4.62E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	2.34E-16	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	6.36E-06	NA	mr1692	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	1.24E-17	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	1.85E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	8.27E-15	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	3.42E-06	2.51E-07	mr1921	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	6.74E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	7.39E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	7.53E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205099249	NA	1.15E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251