Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205050888:

Variant ID: vg0205050888 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5050888
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAATCCACCAAAACCCCATATTGATATTACTGTTCGATCTAACTCCTTGGGATCTAGCCATCTGCCAAGCAGCTCCATGTCTTCTTTCATCCCAACAAT[G/A]
TCATCTCCTTTAACGGCATGAGGAGAACCATTAGATGACAGGAGATGAATATGAGCACTATCACTAGTGTTGTCAAGTAATTCATTGAACATTTCTCGAT

Reverse complement sequence

ATCGAGAAATGTTCAATGAATTACTTGACAACACTAGTGATAGTGCTCATATTCATCTCCTGTCATCTAATGGTTCTCCTCATGCCGTTAAAGGAGATGA[C/T]
ATTGTTGGGATGAAAGAAGACATGGAGCTGCTTGGCAGATGGCTAGATCCCAAGGAGTTAGATCGAACAGTAATATCAATATGGGGTTTTGGTGGATTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.20% 2.40% 1.40% 0.00% NA
All Indica  2759 99.70% 0.00% 0.22% 0.00% NA
All Japonica  1512 88.90% 7.20% 3.90% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 81.20% 12.50% 6.26% 0.00% NA
Tropical Japonica  504 98.00% 1.20% 0.79% 0.00% NA
Japonica Intermediate  241 94.20% 2.90% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205050888 G -> A LOC_Os02g09790.1 synonymous_variant ; p.Asp170Asp; LOW synonymous_codon Average:69.084; most accessible tissue: Minghui63 flag leaf, score: 87.98 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0205050888 G A 0.0 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205050888 NA 5.56E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205050888 1.36E-06 1.36E-06 mr1322_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205050888 2.16E-06 NA mr1324_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205050888 2.25E-06 2.25E-06 mr1326_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251