\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205039940:

Variant ID: vg0205039940 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5039940
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, G: 0.11, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCTACATCTTGATTAGAATGAATAGGTTCTTTCTCACATCATAAATCTGTTGCCAAGTAAAATAATGTAGCAAGCGGTAGTCATGATAAAGCTGATGC[T/G]
GCTAACAGAATACTTGTCCCGTGTTTTCAGAATATGTTGCCCTCAATTGCCAGTTTTTTCATCTCAGTGAACTGAAAAAACTTCTACAGGCATTCACATT

Reverse complement sequence

AATGTGAATGCCTGTAGAAGTTTTTTCAGTTCACTGAGATGAAAAAACTGGCAATTGAGGGCAACATATTCTGAAAACACGGGACAAGTATTCTGTTAGC[A/C]
GCATCAGCTTTATCATGACTACCGCTTGCTACATTATTTTACTTGGCAACAGATTTATGATGTGAGAAAGAACCTATTCATTCTAATCAAGATGTAGAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 12.90% 0.00% 0.00% NA
All Indica  2759 78.40% 21.60% 0.00% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 74.20% 25.80% 0.00% 0.00% NA
Indica III  913 64.00% 36.00% 0.00% 0.00% NA
Indica Intermediate  786 81.40% 18.60% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205039940 T -> G LOC_Os02g09770.1 intron_variant ; MODIFIER silent_mutation Average:56.792; most accessible tissue: Callus, score: 77.692 N N N N
vg0205039940 T -> G LOC_Os02g09770.4 intron_variant ; MODIFIER silent_mutation Average:56.792; most accessible tissue: Callus, score: 77.692 N N N N
vg0205039940 T -> G LOC_Os02g09770.3 intron_variant ; MODIFIER silent_mutation Average:56.792; most accessible tissue: Callus, score: 77.692 N N N N
vg0205039940 T -> G LOC_Os02g09770.2 intron_variant ; MODIFIER silent_mutation Average:56.792; most accessible tissue: Callus, score: 77.692 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205039940 NA 3.08E-06 mr1541_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205039940 NA 2.79E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205039940 NA 9.37E-06 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205039940 NA 6.23E-06 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205039940 2.06E-06 5.34E-09 mr1767_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205039940 NA 5.23E-06 mr1790_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205039940 NA 2.15E-09 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251