\
| Variant ID: vg0205039940 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5039940 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, G: 0.11, others allele: 0.00, population size: 254. )
CTTCTACATCTTGATTAGAATGAATAGGTTCTTTCTCACATCATAAATCTGTTGCCAAGTAAAATAATGTAGCAAGCGGTAGTCATGATAAAGCTGATGC[T/G]
GCTAACAGAATACTTGTCCCGTGTTTTCAGAATATGTTGCCCTCAATTGCCAGTTTTTTCATCTCAGTGAACTGAAAAAACTTCTACAGGCATTCACATT
AATGTGAATGCCTGTAGAAGTTTTTTCAGTTCACTGAGATGAAAAAACTGGCAATTGAGGGCAACATATTCTGAAAACACGGGACAAGTATTCTGTTAGC[A/C]
GCATCAGCTTTATCATGACTACCGCTTGCTACATTATTTTACTTGGCAACAGATTTATGATGTGAGAAAGAACCTATTCATTCTAATCAAGATGTAGAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 74.20% | 25.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 64.00% | 36.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205039940 | T -> G | LOC_Os02g09770.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.792; most accessible tissue: Callus, score: 77.692 | N | N | N | N |
| vg0205039940 | T -> G | LOC_Os02g09770.4 | intron_variant ; MODIFIER | silent_mutation | Average:56.792; most accessible tissue: Callus, score: 77.692 | N | N | N | N |
| vg0205039940 | T -> G | LOC_Os02g09770.3 | intron_variant ; MODIFIER | silent_mutation | Average:56.792; most accessible tissue: Callus, score: 77.692 | N | N | N | N |
| vg0205039940 | T -> G | LOC_Os02g09770.2 | intron_variant ; MODIFIER | silent_mutation | Average:56.792; most accessible tissue: Callus, score: 77.692 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205039940 | NA | 3.08E-06 | mr1541_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205039940 | NA | 2.79E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205039940 | NA | 9.37E-06 | mr1636_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205039940 | NA | 6.23E-06 | mr1705_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205039940 | 2.06E-06 | 5.34E-09 | mr1767_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205039940 | NA | 5.23E-06 | mr1790_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205039940 | NA | 2.15E-09 | mr1805_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |