Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0205034600:

Variant ID: vg0205034600 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5034600
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.17, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CTATGTTTTACAATGTAAGACTTTCTAGCATTGTCCACATACATATAGATGTTAATAAATCTAGACACATACATATGCCGGATGTGGACAATGTTAGAAA[A/G]
TCTTACAGTGTGAAACGGAGGAAGTAGCTAGGTGCTAATTACCACTTGCTCATTTGGGGCTAAGCGTAGGCCTGTCGATTAGTCATTTGTCAAGCTGCTG

Reverse complement sequence

CAGCAGCTTGACAAATGACTAATCGACAGGCCTACGCTTAGCCCCAAATGAGCAAGTGGTAATTAGCACCTAGCTACTTCCTCCGTTTCACACTGTAAGA[T/C]
TTTCTAACATTGTCCACATCCGGCATATGTATGTGTCTAGATTTATTAACATCTATATGTATGTGGACAATGCTAGAAAGTCTTACATTGTAAAACATAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	35.70%	0.74%	0.93%	NA
All Indica	2759	49.60%	48.90%	0.47%	0.98%	NA
All Japonica	1512	99.10%	0.80%	0.13%	0.00%	NA
Aus	269	9.30%	82.20%	3.72%	4.83%	NA
Indica I	595	65.90%	33.90%	0.17%	0.00%	NA
Indica II	465	33.10%	65.60%	1.08%	0.22%	NA
Indica III	913	46.10%	51.20%	0.44%	2.30%	NA
Indica Intermediate	786	51.10%	47.80%	0.38%	0.64%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.10%	0.83%	0.00%	NA
VI/Aromatic	96	12.50%	77.10%	6.25%	4.17%	NA
Intermediate	90	64.40%	31.10%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205034600	A -> G	LOC_Os02g09750.1	upstream_gene_variant ; 4180.0bp to feature; MODIFIER	silent_mutation	Average:77.062; most accessible tissue: Callus, score: 94.055	N	N	N	N
vg0205034600	A -> G	LOC_Os02g09760.1	upstream_gene_variant ; 289.0bp to feature; MODIFIER	silent_mutation	Average:77.062; most accessible tissue: Callus, score: 94.055	N	N	N	N
vg0205034600	A -> G	LOC_Os02g09770.1	downstream_gene_variant ; 4304.0bp to feature; MODIFIER	silent_mutation	Average:77.062; most accessible tissue: Callus, score: 94.055	N	N	N	N
vg0205034600	A -> G	LOC_Os02g09770.4	downstream_gene_variant ; 3859.0bp to feature; MODIFIER	silent_mutation	Average:77.062; most accessible tissue: Callus, score: 94.055	N	N	N	N
vg0205034600	A -> G	LOC_Os02g09770.3	downstream_gene_variant ; 3861.0bp to feature; MODIFIER	silent_mutation	Average:77.062; most accessible tissue: Callus, score: 94.055	N	N	N	N
vg0205034600	A -> G	LOC_Os02g09770.2	downstream_gene_variant ; 4304.0bp to feature; MODIFIER	silent_mutation	Average:77.062; most accessible tissue: Callus, score: 94.055	N	N	N	N
vg0205034600	A -> G	LOC_Os02g09760-LOC_Os02g09770	intergenic_region ; MODIFIER	silent_mutation	Average:77.062; most accessible tissue: Callus, score: 94.055	N	N	N	N
vg0205034600	A -> DEL	N	N	silent_mutation	Average:77.062; most accessible tissue: Callus, score: 94.055	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0205034600	A	G	0.0	-0.05	-0.05	0.02	0.02	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205034600	NA	2.44E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600	NA	5.79E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600	NA	4.18E-07	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600	NA	4.90E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600	NA	6.33E-12	mr1004_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600	NA	1.53E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600	NA	3.06E-07	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600	NA	9.30E-11	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600	NA	4.47E-09	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600	NA	8.52E-08	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251