\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205034600:

Variant ID: vg0205034600 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5034600
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.17, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CTATGTTTTACAATGTAAGACTTTCTAGCATTGTCCACATACATATAGATGTTAATAAATCTAGACACATACATATGCCGGATGTGGACAATGTTAGAAA[A/G]
TCTTACAGTGTGAAACGGAGGAAGTAGCTAGGTGCTAATTACCACTTGCTCATTTGGGGCTAAGCGTAGGCCTGTCGATTAGTCATTTGTCAAGCTGCTG

Reverse complement sequence

CAGCAGCTTGACAAATGACTAATCGACAGGCCTACGCTTAGCCCCAAATGAGCAAGTGGTAATTAGCACCTAGCTACTTCCTCCGTTTCACACTGTAAGA[T/C]
TTTCTAACATTGTCCACATCCGGCATATGTATGTGTCTAGATTTATTAACATCTATATGTATGTGGACAATGCTAGAAAGTCTTACATTGTAAAACATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 35.70% 0.74% 0.93% NA
All Indica  2759 49.60% 48.90% 0.47% 0.98% NA
All Japonica  1512 99.10% 0.80% 0.13% 0.00% NA
Aus  269 9.30% 82.20% 3.72% 4.83% NA
Indica I  595 65.90% 33.90% 0.17% 0.00% NA
Indica II  465 33.10% 65.60% 1.08% 0.22% NA
Indica III  913 46.10% 51.20% 0.44% 2.30% NA
Indica Intermediate  786 51.10% 47.80% 0.38% 0.64% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.10% 0.83% 0.00% NA
VI/Aromatic  96 12.50% 77.10% 6.25% 4.17% NA
Intermediate  90 64.40% 31.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205034600 A -> G LOC_Os02g09750.1 upstream_gene_variant ; 4180.0bp to feature; MODIFIER silent_mutation Average:77.062; most accessible tissue: Callus, score: 94.055 N N N N
vg0205034600 A -> G LOC_Os02g09760.1 upstream_gene_variant ; 289.0bp to feature; MODIFIER silent_mutation Average:77.062; most accessible tissue: Callus, score: 94.055 N N N N
vg0205034600 A -> G LOC_Os02g09770.1 downstream_gene_variant ; 4304.0bp to feature; MODIFIER silent_mutation Average:77.062; most accessible tissue: Callus, score: 94.055 N N N N
vg0205034600 A -> G LOC_Os02g09770.4 downstream_gene_variant ; 3859.0bp to feature; MODIFIER silent_mutation Average:77.062; most accessible tissue: Callus, score: 94.055 N N N N
vg0205034600 A -> G LOC_Os02g09770.3 downstream_gene_variant ; 3861.0bp to feature; MODIFIER silent_mutation Average:77.062; most accessible tissue: Callus, score: 94.055 N N N N
vg0205034600 A -> G LOC_Os02g09770.2 downstream_gene_variant ; 4304.0bp to feature; MODIFIER silent_mutation Average:77.062; most accessible tissue: Callus, score: 94.055 N N N N
vg0205034600 A -> G LOC_Os02g09760-LOC_Os02g09770 intergenic_region ; MODIFIER silent_mutation Average:77.062; most accessible tissue: Callus, score: 94.055 N N N N
vg0205034600 A -> DEL N N silent_mutation Average:77.062; most accessible tissue: Callus, score: 94.055 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0205034600 A G 0.0 -0.05 -0.05 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205034600 NA 2.44E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600 NA 5.79E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600 NA 4.18E-07 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600 NA 4.90E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600 NA 6.33E-12 mr1004_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600 NA 1.53E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600 NA 3.06E-07 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600 NA 9.30E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600 NA 4.47E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205034600 NA 8.52E-08 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251