\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205031937:

Variant ID: vg0205031937 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 5031937
Reference Allele: TAAAAAlternative Allele: TAAA,AAAAA,TAAAAA,T,TAA,TA
Primary Allele: TAAAASecondary Allele: AAAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTAGTACTTTTGCAATGTCAAAACTTTTGCTACCAAAACTTTTATCATTTGCCATTTACCATTCCAAATGGATCTAAACAGGCCCAAAGATGTTTTTTT[TAAAA/TAAA,AAAAA,TAAAAA,T,TAA,TA]
AAAAATTGAACTACTGTGTTTTTCTAAGAGGATTTTTTTAAAAATTTTTGAACGTTTCTAATTTTTAATTTTAAAAATAAACCCTTTTAAAACTTATTTT

Reverse complement sequence

AAAATAAGTTTTAAAAGGGTTTATTTTTAAAATTAAAAATTAGAAACGTTCAAAAATTTTTAAAAAAATCCTCTTAGAAAAACACAGTAGTTCAATTTTT[TTTTA/TTTA,TTTTT,TTTTTA,A,TTA,TA]
AAAAAAACATCTTTGGGCCTGTTTAGATCCATTTGGAATGGTAAATGGCAAATGATAAAAGTTTTGGTAGCAAAAGTTTTGACATTGCAAAAGTACTAGT

Allele Frequencies:

Populations Population SizeFrequency of TAAAA(primary allele) Frequency of AAAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.30% 25.70% 5.82% 0.00% TAAA: 21.71%; TAAAAA: 0.38%; TAA: 0.04%; TA: 0.02%; T: 0.02%
All Indica  2759 69.20% 3.70% 2.03% 0.00% TAAA: 24.72%; TAAAAA: 0.29%; TA: 0.04%; T: 0.04%
All Japonica  1512 14.00% 70.70% 14.02% 0.00% TAAA: 0.66%; TAAAAA: 0.60%
Aus  269 10.80% 1.10% 1.49% 0.00% TAAA: 85.87%; TAA: 0.74%
Indica I  595 96.30% 0.80% 2.52% 0.00% TAAA: 0.34%
Indica II  465 77.80% 0.60% 1.51% 0.00% TAAA: 20.00%
Indica III  913 49.50% 7.30% 0.55% 0.00% TAAA: 41.73%; TAAAAA: 0.66%; TA: 0.11%; T: 0.11%
Indica Intermediate  786 66.50% 3.30% 3.69% 0.00% TAAA: 26.21%; TAAAAA: 0.25%
Temperate Japonica  767 20.10% 59.60% 19.56% 0.00% TAAAAA: 0.65%; TAAA: 0.13%
Tropical Japonica  504 5.80% 87.10% 5.95% 0.00% TAAAAA: 0.79%; TAAA: 0.40%
Japonica Intermediate  241 12.00% 71.80% 13.28% 0.00% TAAA: 2.90%
VI/Aromatic  96 6.20% 9.40% 1.04% 0.00% TAAA: 83.33%
Intermediate  90 33.30% 37.80% 2.22% 0.00% TAAA: 25.56%; TAAAAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205031937 TAAAA -> TA LOC_Os02g09750.1 upstream_gene_variant ; 1519.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TA LOC_Os02g09740.1 downstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TA LOC_Os02g09760.1 downstream_gene_variant ; 1377.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TA LOC_Os02g09740.2 downstream_gene_variant ; 3911.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TA LOC_Os02g09750-LOC_Os02g09760 intergenic_region ; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> AAAAA LOC_Os02g09750.1 upstream_gene_variant ; 1517.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> AAAAA LOC_Os02g09740.1 downstream_gene_variant ; 3909.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> AAAAA LOC_Os02g09760.1 downstream_gene_variant ; 1379.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> AAAAA LOC_Os02g09740.2 downstream_gene_variant ; 3909.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> AAAAA LOC_Os02g09750-LOC_Os02g09760 intergenic_region ; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAA LOC_Os02g09750.1 upstream_gene_variant ; 1520.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAA LOC_Os02g09740.1 downstream_gene_variant ; 3912.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAA LOC_Os02g09760.1 downstream_gene_variant ; 1376.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAA LOC_Os02g09740.2 downstream_gene_variant ; 3912.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAA LOC_Os02g09750-LOC_Os02g09760 intergenic_region ; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAAA LOC_Os02g09750.1 upstream_gene_variant ; 1521.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAAA LOC_Os02g09740.1 downstream_gene_variant ; 3913.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAAA LOC_Os02g09760.1 downstream_gene_variant ; 1375.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAAA LOC_Os02g09740.2 downstream_gene_variant ; 3913.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAAA LOC_Os02g09750-LOC_Os02g09760 intergenic_region ; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> T LOC_Os02g09750.1 upstream_gene_variant ; 1518.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> T LOC_Os02g09740.1 downstream_gene_variant ; 3910.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> T LOC_Os02g09760.1 downstream_gene_variant ; 1378.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> T LOC_Os02g09740.2 downstream_gene_variant ; 3910.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> T LOC_Os02g09750-LOC_Os02g09760 intergenic_region ; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAAAAA LOC_Os02g09750.1 upstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAAAAA LOC_Os02g09740.1 downstream_gene_variant ; 3914.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAAAAA LOC_Os02g09760.1 downstream_gene_variant ; 1374.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAAAAA LOC_Os02g09740.2 downstream_gene_variant ; 3914.0bp to feature; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0205031937 TAAAA -> TAAAAA LOC_Os02g09750-LOC_Os02g09760 intergenic_region ; MODIFIER silent_mutation Average:47.828; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205031937 1.82E-06 1.45E-09 mr1322_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205031937 1.56E-06 NA mr1326_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205031937 4.55E-06 NA mr1333_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205031937 8.20E-06 NA mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205031937 8.94E-06 NA mr1470_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205031937 NA 1.88E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205031937 1.25E-06 NA mr1744_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205031937 3.05E-06 NA mr1879_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251