| Variant ID: vg0204918488 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 4918488 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, T: 0.24, others allele: 0.00, population size: 76. )
GCATTCATTACCCCCATAGGAACTTATTGTTATACGACAATGCCTTTCGGGTTAAAGAATGCAGGTCCTACTTTTCAACGTACTACTCGAATTTCTTTGG[T/G]
TAGCCAAATAGGACGTAATGTTGAGGCCTATGTTGATGACTTGGTTGTGAAAACACGCAACCAGGAGACCTTACTCTCGGATCTAGCGGAAACTTTCGAA
TTCGAAAGTTTCCGCTAGATCCGAGAGTAAGGTCTCCTGGTTGCGTGTTTTCACAACCAAGTCATCAACATAGGCCTCAACATTACGTCCTATTTGGCTA[A/C]
CCAAAGAAATTCGAGTAGTACGTTGAAAAGTAGGACCTGCATTCTTTAACCCGAAAGGCATTGTCGTATAACAATAAGTTCCTATGGGGGTAATGAATGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.90% | 20.80% | 6.62% | 30.66% | NA |
| All Indica | 2759 | 48.50% | 1.20% | 10.69% | 39.65% | NA |
| All Japonica | 1512 | 38.00% | 61.20% | 0.07% | 0.73% | NA |
| Aus | 269 | 9.30% | 0.00% | 3.35% | 87.36% | NA |
| Indica I | 595 | 62.70% | 1.20% | 5.71% | 30.42% | NA |
| Indica II | 465 | 46.20% | 1.70% | 6.24% | 45.81% | NA |
| Indica III | 913 | 36.80% | 0.30% | 17.42% | 45.45% | NA |
| Indica Intermediate | 786 | 52.70% | 1.80% | 9.29% | 36.26% | NA |
| Temperate Japonica | 767 | 6.50% | 93.00% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 90.90% | 8.50% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 27.40% | 70.50% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 8.30% | 1.00% | 4.17% | 86.46% | NA |
| Intermediate | 90 | 41.10% | 25.60% | 4.44% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0204918488 | T -> G | LOC_Os02g09550.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:10.596; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 | N | N | N | N |
| vg0204918488 | T -> G | LOC_Os02g09560.1 | downstream_gene_variant ; 3607.0bp to feature; MODIFIER | silent_mutation | Average:10.596; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 | N | N | N | N |
| vg0204918488 | T -> DEL | N | N | silent_mutation | Average:10.596; most accessible tissue: Zhenshan97 flag leaf, score: 18.298 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0204918488 | NA | 5.68E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204918488 | NA | 4.98E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204918488 | NA | 5.48E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204918488 | NA | 2.91E-06 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204918488 | NA | 1.47E-06 | mr1682 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204918488 | NA | 1.51E-29 | mr1789 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204918488 | NA | 2.65E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204918488 | NA | 2.16E-09 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204918488 | NA | 4.37E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204918488 | 3.27E-06 | 5.57E-21 | mr1682_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/