\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204906205:

Variant ID: vg0204906205 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4906205
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, C: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCAAAAACGGGACAAGGTTTTCACCCAGAGCTCCTTACCGAGGGAGGAGGGGTACCTCAACAATGCCCTCACGCCCGAAAGCATAGTCACTGTTGGCC[T/C,A]
AAAGATTGGGCTAAGCTTTCGCTCGGAACCGCCTACCGCTATGGTCTGTCGCTTAATCCGAAACCACCAACTAAACATCGGCGACACATGGCTTCTGCCA

Reverse complement sequence

TGGCAGAAGCCATGTGTCGCCGATGTTTAGTTGGTGGTTTCGGATTAAGCGACAGACCATAGCGGTAGGCGGTTCCGAGCGAAAGCTTAGCCCAATCTTT[A/G,T]
GGCCAACAGTGACTATGCTTTCGGGCGTGAGGGCATTGTTGAGGTACCCCTCCTCCCTCGGTAAGGAGCTCTGGGTGAAAACCTTGTCCCGTTTTTGGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 6.20% 0.02% 0.00% A: 0.04%
All Indica  2759 91.30% 8.60% 0.00% 0.00% A: 0.07%
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 84.40% 15.20% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 73.10% 26.90% 0.00% 0.00% NA
Indica III  913 93.20% 6.60% 0.00% 0.00% A: 0.22%
Indica Intermediate  786 93.30% 6.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204906205 T -> A LOC_Os02g09520.1 upstream_gene_variant ; 777.0bp to feature; MODIFIER silent_mutation Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0204906205 T -> A LOC_Os02g09530.1 downstream_gene_variant ; 2597.0bp to feature; MODIFIER silent_mutation Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0204906205 T -> A LOC_Os02g09510-LOC_Os02g09520 intergenic_region ; MODIFIER silent_mutation Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0204906205 T -> C LOC_Os02g09520.1 upstream_gene_variant ; 777.0bp to feature; MODIFIER silent_mutation Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0204906205 T -> C LOC_Os02g09530.1 downstream_gene_variant ; 2597.0bp to feature; MODIFIER silent_mutation Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0204906205 T -> C LOC_Os02g09510-LOC_Os02g09520 intergenic_region ; MODIFIER silent_mutation Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204906205 NA 4.41E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205 NA 1.87E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205 NA 4.50E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205 6.68E-07 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205 4.37E-06 NA mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205 NA 5.22E-09 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205 1.85E-06 NA mr1495_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205 NA 2.24E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251