Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0204906205:

Variant ID: vg0204906205 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 4906205
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, C: 0.11, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TCCCAAAAACGGGACAAGGTTTTCACCCAGAGCTCCTTACCGAGGGAGGAGGGGTACCTCAACAATGCCCTCACGCCCGAAAGCATAGTCACTGTTGGCC[T/C,A]
AAAGATTGGGCTAAGCTTTCGCTCGGAACCGCCTACCGCTATGGTCTGTCGCTTAATCCGAAACCACCAACTAAACATCGGCGACACATGGCTTCTGCCA

Reverse complement sequence

TGGCAGAAGCCATGTGTCGCCGATGTTTAGTTGGTGGTTTCGGATTAAGCGACAGACCATAGCGGTAGGCGGTTCCGAGCGAAAGCTTAGCCCAATCTTT[A/G,T]
GGCCAACAGTGACTATGCTTTCGGGCGTGAGGGCATTGTTGAGGTACCCCTCCTCCCTCGGTAAGGAGCTCTGGGTGAAAACCTTGTCCCGTTTTTGGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	6.20%	0.02%	0.00%	A: 0.04%
All Indica	2759	91.30%	8.60%	0.00%	0.00%	A: 0.07%
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	84.40%	15.20%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	73.10%	26.90%	0.00%	0.00%	NA
Indica III	913	93.20%	6.60%	0.00%	0.00%	A: 0.22%
Indica Intermediate	786	93.30%	6.70%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204906205	T -> A	LOC_Os02g09520.1	upstream_gene_variant ; 777.0bp to feature; MODIFIER	silent_mutation	Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0204906205	T -> A	LOC_Os02g09530.1	downstream_gene_variant ; 2597.0bp to feature; MODIFIER	silent_mutation	Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0204906205	T -> A	LOC_Os02g09510-LOC_Os02g09520	intergenic_region ; MODIFIER	silent_mutation	Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0204906205	T -> C	LOC_Os02g09520.1	upstream_gene_variant ; 777.0bp to feature; MODIFIER	silent_mutation	Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0204906205	T -> C	LOC_Os02g09530.1	downstream_gene_variant ; 2597.0bp to feature; MODIFIER	silent_mutation	Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N
vg0204906205	T -> C	LOC_Os02g09510-LOC_Os02g09520	intergenic_region ; MODIFIER	silent_mutation	Average:61.768; most accessible tissue: Zhenshan97 panicle, score: 81.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204906205	NA	4.41E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205	NA	1.87E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205	NA	4.50E-06	mr1098_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205	6.68E-07	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205	4.37E-06	NA	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205	NA	5.22E-09	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205	1.85E-06	NA	mr1495_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204906205	NA	2.24E-06	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251