\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204867199:

Variant ID: vg0204867199 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4867199
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CTTATTTTTTAATTCCGAATTTTAACTATTTCTAAATTGTATTTCTATATGGACTCTGTTTTTTCTTTTTCTCCGATTAATGTAAGAATTTCTAGGCCAT[G/A]
AGAACGAACGTGGGAGCTACTTTTTCTATTACTTTAATAATATAATAGATTTTGTTGGCAGCTCATGAGTAGTAAAATTATTTTGGCACTATAAACTGAA

Reverse complement sequence

TTCAGTTTATAGTGCCAAAATAATTTTACTACTCATGAGCTGCCAACAAAATCTATTATATTATTAAAGTAATAGAAAAAGTAGCTCCCACGTTCGTTCT[C/T]
ATGGCCTAGAAATTCTTACATTAATCGGAGAAAAAGAAAAAACAGAGTCCATATAGAAATACAATTTAGAAATAGTTAAAATTCGGAATTAAAAAATAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 47.00% 1.90% 0.17% NA
All Indica  2759 39.70% 57.10% 3.15% 0.04% NA
All Japonica  1512 66.90% 32.60% 0.13% 0.40% NA
Aus  269 71.70% 28.30% 0.00% 0.00% NA
Indica I  595 27.10% 68.60% 4.37% 0.00% NA
Indica II  465 48.60% 49.20% 2.15% 0.00% NA
Indica III  913 44.10% 55.20% 0.55% 0.11% NA
Indica Intermediate  786 38.90% 55.20% 5.85% 0.00% NA
Temperate Japonica  767 93.90% 6.10% 0.00% 0.00% NA
Tropical Japonica  504 34.90% 64.30% 0.20% 0.60% NA
Japonica Intermediate  241 47.70% 50.60% 0.41% 1.24% NA
VI/Aromatic  96 50.00% 49.00% 1.04% 0.00% NA
Intermediate  90 63.30% 35.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204867199 G -> A LOC_Os02g09480.1 upstream_gene_variant ; 475.0bp to feature; MODIFIER silent_mutation Average:90.156; most accessible tissue: Callus, score: 96.271 N N N N
vg0204867199 G -> A LOC_Os02g09470.1 downstream_gene_variant ; 4324.0bp to feature; MODIFIER silent_mutation Average:90.156; most accessible tissue: Callus, score: 96.271 N N N N
vg0204867199 G -> A LOC_Os02g09490.1 downstream_gene_variant ; 2943.0bp to feature; MODIFIER silent_mutation Average:90.156; most accessible tissue: Callus, score: 96.271 N N N N
vg0204867199 G -> A LOC_Os02g09470-LOC_Os02g09480 intergenic_region ; MODIFIER silent_mutation Average:90.156; most accessible tissue: Callus, score: 96.271 N N N N
vg0204867199 G -> DEL N N silent_mutation Average:90.156; most accessible tissue: Callus, score: 96.271 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0204867199 G A -0.01 -0.01 -0.01 0.0 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204867199 NA 1.19E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 2.19E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 1.12E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 1.84E-09 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 1.10E-06 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 3.39E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 7.15E-09 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 3.67E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 3.89E-09 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 2.23E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 1.86E-07 mr1036_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 4.31E-07 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 1.84E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 6.23E-06 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 7.43E-07 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 3.41E-06 mr1620_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 4.21E-15 mr1829_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 6.86E-11 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 1.79E-12 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 4.73E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204867199 NA 9.65E-06 mr1994_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251