\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204866147:

Variant ID: vg0204866147 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4866147
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GAATCTAAAGACAGTGATGAAAAAGAAAATTAGCATAACGAAAATATAAATATGAAGTACTTTCTCCGTTTCAGATTATAAGACTTTCTAACATTGATAA[C/T]
ATTCACTTTCTGTGAATGTTATCAATGTTAGAAAGTCTTATAATATGAAACGGAGGAAGTATGTACGAAATCCGGTTTTAAAATGTAAACTAGTATGATG

Reverse complement sequence

CATCATACTAGTTTACATTTTAAAACCGGATTTCGTACATACTTCCTCCGTTTCATATTATAAGACTTTCTAACATTGATAACATTCACAGAAAGTGAAT[G/A]
TTATCAATGTTAGAAAGTCTTATAATCTGAAACGGAGAAAGTACTTCATATTTATATTTTCGTTATGCTAATTTTCTTTTTCATCACTGTCTTTAGATTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 40.30% 1.02% 1.25% NA
All Indica  2759 74.00% 22.40% 1.52% 2.10% NA
All Japonica  1512 33.40% 66.50% 0.07% 0.07% NA
Aus  269 29.40% 70.30% 0.37% 0.00% NA
Indica I  595 95.00% 1.70% 1.18% 2.18% NA
Indica II  465 59.10% 35.50% 1.29% 4.09% NA
Indica III  913 65.70% 31.50% 1.75% 0.99% NA
Indica Intermediate  786 76.50% 19.70% 1.65% 2.16% NA
Temperate Japonica  767 6.00% 93.90% 0.00% 0.13% NA
Tropical Japonica  504 65.70% 34.30% 0.00% 0.00% NA
Japonica Intermediate  241 53.10% 46.50% 0.41% 0.00% NA
VI/Aromatic  96 53.10% 44.80% 2.08% 0.00% NA
Intermediate  90 44.40% 53.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204866147 C -> T LOC_Os02g09480.1 upstream_gene_variant ; 1527.0bp to feature; MODIFIER silent_mutation Average:83.816; most accessible tissue: Minghui63 young leaf, score: 94.888 N N N N
vg0204866147 C -> T LOC_Os02g09470.1 downstream_gene_variant ; 3272.0bp to feature; MODIFIER silent_mutation Average:83.816; most accessible tissue: Minghui63 young leaf, score: 94.888 N N N N
vg0204866147 C -> T LOC_Os02g09490.1 downstream_gene_variant ; 3995.0bp to feature; MODIFIER silent_mutation Average:83.816; most accessible tissue: Minghui63 young leaf, score: 94.888 N N N N
vg0204866147 C -> T LOC_Os02g09470-LOC_Os02g09480 intergenic_region ; MODIFIER silent_mutation Average:83.816; most accessible tissue: Minghui63 young leaf, score: 94.888 N N N N
vg0204866147 C -> DEL N N silent_mutation Average:83.816; most accessible tissue: Minghui63 young leaf, score: 94.888 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0204866147 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204866147 NA 3.25E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 5.20E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 2.41E-06 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 2.55E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 1.78E-08 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 3.19E-09 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 1.11E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 6.34E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 1.47E-07 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 1.21E-08 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 4.38E-11 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 2.27E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 3.06E-06 NA mr1809 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 5.42E-09 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 6.84E-07 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 5.97E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 4.67E-08 mr1892 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 4.32E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 3.81E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 1.07E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 2.76E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 3.93E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 4.35E-15 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 3.99E-08 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204866147 NA 2.82E-12 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251