\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204744487:

Variant ID: vg0204744487 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4744487
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTGGTACACATGAGCTCATAGCTGAAATACCAAATACTCATACACGAGAGTCTAGTGTGAATTATTACAACATAAGCCCGCAGGCATTGTCTTAAATC[A/C]
TCGGACCGAGCGGTCCGGAATACAACCAAAAGCAGAATTAGATAAGACAGCGGATTTTAGGCAGCGGCATGCCATTGCCACAGGCAACGACCGTACTAAG

Reverse complement sequence

CTTAGTACGGTCGTTGCCTGTGGCAATGGCATGCCGCTGCCTAAAATCCGCTGTCTTATCTAATTCTGCTTTTGGTTGTATTCCGGACCGCTCGGTCCGA[T/G]
GATTTAAGACAATGCCTGCGGGCTTATGTTGTAATAATTCACACTAGACTCTCGTGTATGAGTATTTGGTATTTCAGCTATGAGCTCATGTGTACCAGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 2.90% 5.82% 23.95% NA
All Indica  2759 61.30% 2.10% 7.25% 29.32% NA
All Japonica  1512 76.40% 4.80% 4.50% 14.29% NA
Aus  269 88.80% 0.00% 0.74% 10.41% NA
Indica I  595 53.30% 0.30% 10.59% 35.80% NA
Indica II  465 53.80% 0.90% 6.45% 38.92% NA
Indica III  913 69.40% 3.70% 5.48% 21.36% NA
Indica Intermediate  786 62.30% 2.40% 7.25% 27.99% NA
Temperate Japonica  767 96.10% 0.30% 1.30% 2.35% NA
Tropical Japonica  504 46.40% 13.10% 8.13% 32.34% NA
Japonica Intermediate  241 76.30% 2.10% 7.05% 14.52% NA
VI/Aromatic  96 36.50% 2.10% 3.12% 58.33% NA
Intermediate  90 71.10% 1.10% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204744487 A -> DEL N N silent_mutation Average:42.454; most accessible tissue: Callus, score: 59.274 N N N N
vg0204744487 A -> C LOC_Os02g09230.1 upstream_gene_variant ; 2766.0bp to feature; MODIFIER silent_mutation Average:42.454; most accessible tissue: Callus, score: 59.274 N N N N
vg0204744487 A -> C LOC_Os02g09220.1 downstream_gene_variant ; 1294.0bp to feature; MODIFIER silent_mutation Average:42.454; most accessible tissue: Callus, score: 59.274 N N N N
vg0204744487 A -> C LOC_Os02g09220-LOC_Os02g09230 intergenic_region ; MODIFIER silent_mutation Average:42.454; most accessible tissue: Callus, score: 59.274 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204744487 NA 3.36E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204744487 NA 1.69E-06 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204744487 NA 6.04E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204744487 NA 6.93E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204744487 1.23E-06 1.84E-11 mr1583 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204744487 NA 2.68E-06 mr1819 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204744487 NA 2.94E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204744487 NA 1.25E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204744487 NA 5.07E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251