\
| Variant ID: vg0204744487 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 4744487 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 263. )
GTCTGGTACACATGAGCTCATAGCTGAAATACCAAATACTCATACACGAGAGTCTAGTGTGAATTATTACAACATAAGCCCGCAGGCATTGTCTTAAATC[A/C]
TCGGACCGAGCGGTCCGGAATACAACCAAAAGCAGAATTAGATAAGACAGCGGATTTTAGGCAGCGGCATGCCATTGCCACAGGCAACGACCGTACTAAG
CTTAGTACGGTCGTTGCCTGTGGCAATGGCATGCCGCTGCCTAAAATCCGCTGTCTTATCTAATTCTGCTTTTGGTTGTATTCCGGACCGCTCGGTCCGA[T/G]
GATTTAAGACAATGCCTGCGGGCTTATGTTGTAATAATTCACACTAGACTCTCGTGTATGAGTATTTGGTATTTCAGCTATGAGCTCATGTGTACCAGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.40% | 2.90% | 5.82% | 23.95% | NA |
| All Indica | 2759 | 61.30% | 2.10% | 7.25% | 29.32% | NA |
| All Japonica | 1512 | 76.40% | 4.80% | 4.50% | 14.29% | NA |
| Aus | 269 | 88.80% | 0.00% | 0.74% | 10.41% | NA |
| Indica I | 595 | 53.30% | 0.30% | 10.59% | 35.80% | NA |
| Indica II | 465 | 53.80% | 0.90% | 6.45% | 38.92% | NA |
| Indica III | 913 | 69.40% | 3.70% | 5.48% | 21.36% | NA |
| Indica Intermediate | 786 | 62.30% | 2.40% | 7.25% | 27.99% | NA |
| Temperate Japonica | 767 | 96.10% | 0.30% | 1.30% | 2.35% | NA |
| Tropical Japonica | 504 | 46.40% | 13.10% | 8.13% | 32.34% | NA |
| Japonica Intermediate | 241 | 76.30% | 2.10% | 7.05% | 14.52% | NA |
| VI/Aromatic | 96 | 36.50% | 2.10% | 3.12% | 58.33% | NA |
| Intermediate | 90 | 71.10% | 1.10% | 2.22% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0204744487 | A -> DEL | N | N | silent_mutation | Average:42.454; most accessible tissue: Callus, score: 59.274 | N | N | N | N |
| vg0204744487 | A -> C | LOC_Os02g09230.1 | upstream_gene_variant ; 2766.0bp to feature; MODIFIER | silent_mutation | Average:42.454; most accessible tissue: Callus, score: 59.274 | N | N | N | N |
| vg0204744487 | A -> C | LOC_Os02g09220.1 | downstream_gene_variant ; 1294.0bp to feature; MODIFIER | silent_mutation | Average:42.454; most accessible tissue: Callus, score: 59.274 | N | N | N | N |
| vg0204744487 | A -> C | LOC_Os02g09220-LOC_Os02g09230 | intergenic_region ; MODIFIER | silent_mutation | Average:42.454; most accessible tissue: Callus, score: 59.274 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0204744487 | NA | 3.36E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204744487 | NA | 1.69E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204744487 | NA | 6.04E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204744487 | NA | 6.93E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204744487 | 1.23E-06 | 1.84E-11 | mr1583 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204744487 | NA | 2.68E-06 | mr1819 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204744487 | NA | 2.94E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204744487 | NA | 1.25E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0204744487 | NA | 5.07E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |