RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0204738973:

Variant ID: vg0204738973 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 4738973
Reference Allele: AAG	Alternative Allele: A,GAG
Primary Allele: AAG	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGGCCACCGCTCGCCGGCCATCGCCTGTCGTCGTCCTCCTCCATGGTGCGTCACCGATCTGTGGGCTGGGATGATGGATCGATGCATATCCCAAAAAAA[AAG/A,GAG]
AGGAAAAAATAAAGTGGGGGCGAGAGTGGTTGGTTGGGTACGGGAAAAATAGAATATATACTGGAATCTGGGAAGTTGTTTTTATCGAAGTAAATCATTT

Reverse complement sequence

AAATGATTTACTTCGATAAAAACAACTTCCCAGATTCCAGTATATATTCTATTTTTCCCGTACCCAACCAACCACTCTCGCCCCCACTTTATTTTTTCCT[CTT/T,CTC]
TTTTTTTGGGATATGCATCGATCCATCATCCCAGCCCACAGATCGGTGACGCACCATGGAGGAGGACGACGACAGGCGATGGCCGGCGAGCGGTGGCCGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of AAG(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	14.80%	4.21%	41.01%	GAG: 1.04%
All Indica	2759	22.90%	12.50%	5.18%	59.44%	NA
All Japonica	1512	55.50%	21.00%	3.31%	17.06%	GAG: 3.11%
Aus	269	85.50%	7.40%	0.37%	6.69%	NA
Indica I	595	0.80%	18.30%	10.08%	70.76%	NA
Indica II	465	31.20%	13.50%	4.73%	50.54%	NA
Indica III	913	32.60%	8.40%	3.94%	54.98%	NA
Indica Intermediate	786	23.40%	12.10%	3.18%	61.32%	NA
Temperate Japonica	767	88.30%	2.00%	2.48%	4.04%	GAG: 3.26%
Tropical Japonica	504	16.10%	45.80%	3.77%	34.33%	NA
Japonica Intermediate	241	33.60%	29.90%	4.98%	22.41%	GAG: 9.13%
VI/Aromatic	96	91.70%	6.20%	1.04%	1.04%	NA
Intermediate	90	55.60%	14.40%	4.44%	23.33%	GAG: 2.22%

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204738973	AAG -> A	LOC_Os02g09220.1	upstream_gene_variant ; 1070.0bp to feature; MODIFIER	silent_mutation	Average:41.596; most accessible tissue: Callus, score: 57.213	N	N	N	N
vg0204738973	AAG -> A	LOC_Os02g09210-LOC_Os02g09220	intergenic_region ; MODIFIER	silent_mutation	Average:41.596; most accessible tissue: Callus, score: 57.213	N	N	N	N
vg0204738973	AAG -> GAG	LOC_Os02g09220.1	upstream_gene_variant ; 1071.0bp to feature; MODIFIER	silent_mutation	Average:41.596; most accessible tissue: Callus, score: 57.213	N	N	N	N
vg0204738973	AAG -> GAG	LOC_Os02g09210-LOC_Os02g09220	intergenic_region ; MODIFIER	silent_mutation	Average:41.596; most accessible tissue: Callus, score: 57.213	N	N	N	N
vg0204738973	AAG -> DEL	N	N	silent_mutation	Average:41.596; most accessible tissue: Callus, score: 57.213	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204738973	1.10E-06	7.72E-07	mr1550	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204738973	3.09E-06	NA	mr1757	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204738973	NA	7.99E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0204738973:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact