Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204345674:

Variant ID: vg0204345674 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 4345674
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

GATATGACATTTCTACCCCTCATTGACATGCATTATACTTGTACTTGTGAGGGGTAGAAACGTCATATCGTATGTGTGGCTGGATCAATAACGATCAAGA[C/T]
GGATGGAAAACGATCGAGAATTGACGGAAGTGTTAAAAATGGAAACATGGTGAACCTTGGGTGCTATTAAAGTGAACCGGTAACTTTCGGTGCTATAAAC

Reverse complement sequence

GTTTATAGCACCGAAAGTTACCGGTTCACTTTAATAGCACCCAAGGTTCACCATGTTTCCATTTTTAACACTTCCGTCAATTCTCGATCGTTTTCCATCC[G/A]
TCTTGATCGTTATTGATCCAGCCACACATACGATATGACGTTTCTACCCCTCACAAGTACAAGTATAATGCATGTCAATGAGGGGTAGAAATGTCATATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	34.40%	0.02%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	2.10%	97.90%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.10%	0.00%	0.00%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	1.80%	98.20%	0.00%	0.00%	NA
Japonica Intermediate	241	6.60%	93.40%	0.00%	0.00%	NA
VI/Aromatic	96	19.80%	80.20%	0.00%	0.00%	NA
Intermediate	90	45.60%	53.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204345674	C -> T	LOC_Os02g08200.1	upstream_gene_variant ; 3507.0bp to feature; MODIFIER	silent_mutation	Average:28.593; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N
vg0204345674	C -> T	LOC_Os02g08210.1	downstream_gene_variant ; 1169.0bp to feature; MODIFIER	silent_mutation	Average:28.593; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N
vg0204345674	C -> T	LOC_Os02g08200-LOC_Os02g08210	intergenic_region ; MODIFIER	silent_mutation	Average:28.593; most accessible tissue: Minghui63 root, score: 51.763	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204345674	NA	1.04E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	1.16E-18	mr1767	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	2.85E-21	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	2.01E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	3.15E-06	2.60E-07	mr1053_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	7.31E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	3.38E-06	9.07E-07	mr1147_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	1.31E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	4.30E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	6.06E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	1.27E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	5.05E-16	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	2.21E-12	mr1641_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	3.44E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	1.71E-16	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	3.57E-13	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	4.73E-32	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	1.93E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204345674	NA	7.62E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251