\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204236989:

Variant ID: vg0204236989 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4236989
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATAAGTGATCTGAGCATTCCACGAATTCTACACCACTAAATTTTTATTTATTTATTAAAAATAAATTAGTTTATGGAAAAACATTTAGAAATTACAGTG[C/T]
AGAACACGATTTTAAGTGAAGAATACTTAGTTTTCTCGGTGGAGAAAAAAGAGCTTTCGTGCCCAATAAGTTGATACGGTTTTCATTATTGTTCTCACTT

Reverse complement sequence

AAGTGAGAACAATAATGAAAACCGTATCAACTTATTGGGCACGAAAGCTCTTTTTTCTCCACCGAGAAAACTAAGTATTCTTCACTTAAAATCGTGTTCT[G/A]
CACTGTAATTTCTAAATGTTTTTCCATAAACTAATTTATTTTTAATAAATAAATAAAAATTTAGTGGTGTAGAATTCGTGGAATGCTCAGATCACTTATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 9.10% 2.26% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 65.50% 27.70% 6.81% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 47.30% 42.80% 9.91% 0.00% NA
Tropical Japonica  504 94.40% 3.20% 2.38% 0.00% NA
Japonica Intermediate  241 62.70% 31.10% 6.22% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 85.60% 11.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204236989 C -> T LOC_Os02g08040.1 downstream_gene_variant ; 1905.0bp to feature; MODIFIER silent_mutation Average:28.538; most accessible tissue: Callus, score: 64.103 N N N N
vg0204236989 C -> T LOC_Os02g08050.1 downstream_gene_variant ; 2064.0bp to feature; MODIFIER silent_mutation Average:28.538; most accessible tissue: Callus, score: 64.103 N N N N
vg0204236989 C -> T LOC_Os02g08040-LOC_Os02g08050 intergenic_region ; MODIFIER silent_mutation Average:28.538; most accessible tissue: Callus, score: 64.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204236989 NA 2.55E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989 NA 5.85E-06 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989 NA 3.37E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989 NA 1.25E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989 6.23E-08 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989 NA 4.10E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989 2.87E-07 9.79E-09 mr1872 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989 NA 2.36E-06 mr1903 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989 NA 1.61E-06 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989 NA 7.99E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251