Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204236989:

Variant ID: vg0204236989 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 4236989
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATAAGTGATCTGAGCATTCCACGAATTCTACACCACTAAATTTTTATTTATTTATTAAAAATAAATTAGTTTATGGAAAAACATTTAGAAATTACAGTG[C/T]
AGAACACGATTTTAAGTGAAGAATACTTAGTTTTCTCGGTGGAGAAAAAAGAGCTTTCGTGCCCAATAAGTTGATACGGTTTTCATTATTGTTCTCACTT

Reverse complement sequence

AAGTGAGAACAATAATGAAAACCGTATCAACTTATTGGGCACGAAAGCTCTTTTTTCTCCACCGAGAAAACTAAGTATTCTTCACTTAAAATCGTGTTCT[G/A]
CACTGTAATTTCTAAATGTTTTTCCATAAACTAATTTATTTTTAATAAATAAATAAAAATTTAGTGGTGTAGAATTCGTGGAATGCTCAGATCACTTATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	9.10%	2.26%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	65.50%	27.70%	6.81%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	47.30%	42.80%	9.91%	0.00%	NA
Tropical Japonica	504	94.40%	3.20%	2.38%	0.00%	NA
Japonica Intermediate	241	62.70%	31.10%	6.22%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	85.60%	11.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204236989	C -> T	LOC_Os02g08040.1	downstream_gene_variant ; 1905.0bp to feature; MODIFIER	silent_mutation	Average:28.538; most accessible tissue: Callus, score: 64.103	N	N	N	N
vg0204236989	C -> T	LOC_Os02g08050.1	downstream_gene_variant ; 2064.0bp to feature; MODIFIER	silent_mutation	Average:28.538; most accessible tissue: Callus, score: 64.103	N	N	N	N
vg0204236989	C -> T	LOC_Os02g08040-LOC_Os02g08050	intergenic_region ; MODIFIER	silent_mutation	Average:28.538; most accessible tissue: Callus, score: 64.103	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204236989	NA	2.55E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989	NA	5.85E-06	mr1070	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989	NA	3.37E-06	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989	NA	1.25E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989	6.23E-08	NA	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989	NA	4.10E-07	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989	2.87E-07	9.79E-09	mr1872	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989	NA	2.36E-06	mr1903	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989	NA	1.61E-06	mr1910	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236989	NA	7.99E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251