\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204236567:

Variant ID: vg0204236567 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4236567
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCTCCCCATTCGCCTCCCTCATCAGTGCCCTTCTCGCCGCCCACCGCATCTAGCTCAACGAGATGGGGAAGAGAGGAGAGGGGACGATGAAGGAAGAA[A/G]
ATTGAACTGACATGTCGGTCCCACATCTAGAGATATTTTGGTCTATATGATGACAGAAAATATGATGTGATGGTATGTTCTAATTTTGTACATATTTAGG

Reverse complement sequence

CCTAAATATGTACAAAATTAGAACATACCATCACATCATATTTTCTGTCATCATATAGACCAAAATATCTCTAGATGTGGGACCGACATGTCAGTTCAAT[T/C]
TTCTTCCTTCATCGTCCCCTCTCCTCTCTTCCCCATCTCGTTGAGCTAGATGCGGTGGGCGGCGAGAAGGGCACTGATGAGGGAGGCGAATGGGGAGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 9.20% 2.26% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 65.50% 27.70% 6.81% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 47.30% 42.80% 9.91% 0.00% NA
Tropical Japonica  504 94.40% 3.20% 2.38% 0.00% NA
Japonica Intermediate  241 62.70% 31.10% 6.22% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 85.60% 11.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204236567 A -> G LOC_Os02g08040.1 downstream_gene_variant ; 1483.0bp to feature; MODIFIER silent_mutation Average:77.362; most accessible tissue: Callus, score: 95.749 N N N N
vg0204236567 A -> G LOC_Os02g08050.1 downstream_gene_variant ; 2486.0bp to feature; MODIFIER silent_mutation Average:77.362; most accessible tissue: Callus, score: 95.749 N N N N
vg0204236567 A -> G LOC_Os02g08040-LOC_Os02g08050 intergenic_region ; MODIFIER silent_mutation Average:77.362; most accessible tissue: Callus, score: 95.749 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0204236567 A G -0.03 -0.06 -0.04 -0.04 -0.05 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204236567 NA 1.66E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 NA 9.38E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 NA 2.29E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 NA 5.51E-06 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 NA 2.75E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 9.68E-06 9.68E-06 mr1128 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 NA 1.81E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 NA 6.97E-06 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 1.36E-08 NA mr1745 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 NA 4.81E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 4.47E-07 1.47E-08 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 NA 2.83E-06 mr1903 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204236567 NA 1.10E-06 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251