Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0204233998:

Variant ID: vg0204233998 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4233998
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATGCATTGTCCGCACTCAATCAACAAAGGATTGGAAGTTTGACTAAAATTGGAAGTTTGAAGAAAAAAGTTGGAAGTTTATGTGTGAAGGAAAGTTT[C/T]
GATGTGATGGAAAAGTTGGAAGTTTGAAGAAAAAGTTGGGAACTAAACTAGGCCAAAGTATATGGATGTGAAATTTAAGATTTCATCTAGAATGTAAGCC

Reverse complement sequence

GGCTTACATTCTAGATGAAATCTTAAATTTCACATCCATATACTTTGGCCTAGTTTAGTTCCCAACTTTTTCTTCAAACTTCCAACTTTTCCATCACATC[G/A]
AAACTTTCCTTCACACATAAACTTCCAACTTTTTTCTTCAAACTTCCAATTTTAGTCAAACTTCCAATCCTTTGTTGATTGAGTGCGGACAATGCATAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.40% 43.50% 0.13% 0.00% NA
All Indica  2759 91.70% 8.10% 0.18% 0.00% NA
All Japonica  1512 6.50% 93.50% 0.00% 0.00% NA
Aus  269 3.00% 97.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 96.30% 3.40% 0.22% 0.00% NA
Indica III  913 84.90% 14.90% 0.22% 0.00% NA
Indica Intermediate  786 91.20% 8.50% 0.25% 0.00% NA
Temperate Japonica  767 12.60% 87.40% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 27.80% 71.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204233998 C -> T LOC_Os02g08040.1 upstream_gene_variant ; 871.0bp to feature; MODIFIER silent_mutation Average:21.385; most accessible tissue: Zhenshan97 flower, score: 31.8 N N N N
vg0204233998 C -> T LOC_Os02g08030-LOC_Os02g08040 intergenic_region ; MODIFIER silent_mutation Average:21.385; most accessible tissue: Zhenshan97 flower, score: 31.8 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204233998 NA 1.32E-26 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 8.53E-19 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 1.17E-06 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 5.44E-09 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 7.05E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 8.68E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 5.79E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 4.17E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 4.73E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 1.66E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 1.09E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 5.91E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 4.46E-06 4.46E-06 mr1647_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 3.78E-13 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 1.85E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 1.33E-44 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204233998 NA 2.33E-29 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251