Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204148254:

Variant ID: vg0204148254 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 4148254
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:

TTTATCTTATTTGATCATATTCTAGAAGTTTCTTCACTATACTATGAGAATTTGACTTTTATATTGGTACCAATCCAAATGTTAGCTGAATAATTTTACT[T/C]
TACTAATATTTTAATATTGCTTTGGCATTGTCGATGAATTGGTAGGCTAAAGGCCGAGTCTAGTTGTTTTGGCAAAAAAAATTGACATATACGAACACAT

Reverse complement sequence

ATGTGTTCGTATATGTCAATTTTTTTTGCCAAAACAACTAGACTCGGCCTTTAGCCTACCAATTCATCGACAATGCCAAAGCAATATTAAAATATTAGTA[A/G]
AGTAAAATTATTCAGCTAACATTTGGATTGGTACCAATATAAAAGTCAAATTCTCATAGTATAGTGAAGAAACTTCTAGAATATGATCAAATAAGATAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.90%	11.50%	2.60%	0.00%	NA
All Indica	2759	99.00%	0.20%	0.76%	0.00%	NA
All Japonica	1512	58.80%	34.50%	6.68%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	0.00%	1.18%	0.00%	NA
Indica II	465	98.50%	0.20%	1.29%	0.00%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	98.60%	0.50%	0.89%	0.00%	NA
Temperate Japonica	767	30.50%	58.10%	11.34%	0.00%	NA
Tropical Japonica	504	96.80%	2.20%	0.99%	0.00%	NA
Japonica Intermediate	241	69.30%	27.00%	3.73%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204148254	T -> C	LOC_Os02g07920.1	upstream_gene_variant ; 1192.0bp to feature; MODIFIER	silent_mutation	Average:64.909; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg0204148254	T -> C	LOC_Os02g07910.1	downstream_gene_variant ; 4578.0bp to feature; MODIFIER	silent_mutation	Average:64.909; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg0204148254	T -> C	LOC_Os02g07930.1	downstream_gene_variant ; 1516.0bp to feature; MODIFIER	silent_mutation	Average:64.909; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg0204148254	T -> C	LOC_Os02g07910.2	downstream_gene_variant ; 4573.0bp to feature; MODIFIER	silent_mutation	Average:64.909; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N
vg0204148254	T -> C	LOC_Os02g07920-LOC_Os02g07930	intergenic_region ; MODIFIER	silent_mutation	Average:64.909; most accessible tissue: Zhenshan97 flag leaf, score: 79.71	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204148254	NA	6.27E-15	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0204148254	NA	1.08E-16	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0204148254	NA	7.78E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0204148254	NA	3.10E-07	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	7.89E-06	mr1097	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	1.48E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	1.15E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	1.33E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	6.85E-06	2.01E-08	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	4.96E-08	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	1.19E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	6.59E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	1.54E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	3.16E-09	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	5.91E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	2.56E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	1.01E-08	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	2.27E-07	NA	mr1530_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	3.49E-13	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	6.59E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	2.55E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	9.69E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254	NA	2.98E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251