\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204148254:

Variant ID: vg0204148254 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4148254
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATCTTATTTGATCATATTCTAGAAGTTTCTTCACTATACTATGAGAATTTGACTTTTATATTGGTACCAATCCAAATGTTAGCTGAATAATTTTACT[T/C]
TACTAATATTTTAATATTGCTTTGGCATTGTCGATGAATTGGTAGGCTAAAGGCCGAGTCTAGTTGTTTTGGCAAAAAAAATTGACATATACGAACACAT

Reverse complement sequence

ATGTGTTCGTATATGTCAATTTTTTTTGCCAAAACAACTAGACTCGGCCTTTAGCCTACCAATTCATCGACAATGCCAAAGCAATATTAAAATATTAGTA[A/G]
AGTAAAATTATTCAGCTAACATTTGGATTGGTACCAATATAAAAGTCAAATTCTCATAGTATAGTGAAGAAACTTCTAGAATATGATCAAATAAGATAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 11.50% 2.60% 0.00% NA
All Indica  2759 99.00% 0.20% 0.76% 0.00% NA
All Japonica  1512 58.80% 34.50% 6.68% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 0.00% 1.18% 0.00% NA
Indica II  465 98.50% 0.20% 1.29% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 98.60% 0.50% 0.89% 0.00% NA
Temperate Japonica  767 30.50% 58.10% 11.34% 0.00% NA
Tropical Japonica  504 96.80% 2.20% 0.99% 0.00% NA
Japonica Intermediate  241 69.30% 27.00% 3.73% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204148254 T -> C LOC_Os02g07920.1 upstream_gene_variant ; 1192.0bp to feature; MODIFIER silent_mutation Average:64.909; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg0204148254 T -> C LOC_Os02g07910.1 downstream_gene_variant ; 4578.0bp to feature; MODIFIER silent_mutation Average:64.909; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg0204148254 T -> C LOC_Os02g07930.1 downstream_gene_variant ; 1516.0bp to feature; MODIFIER silent_mutation Average:64.909; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg0204148254 T -> C LOC_Os02g07910.2 downstream_gene_variant ; 4573.0bp to feature; MODIFIER silent_mutation Average:64.909; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N
vg0204148254 T -> C LOC_Os02g07920-LOC_Os02g07930 intergenic_region ; MODIFIER silent_mutation Average:64.909; most accessible tissue: Zhenshan97 flag leaf, score: 79.71 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204148254 NA 6.27E-15 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0204148254 NA 1.08E-16 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0204148254 NA 7.78E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0204148254 NA 3.10E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 7.89E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 1.48E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 1.15E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 1.33E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 6.85E-06 2.01E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 4.96E-08 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 1.19E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 6.59E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 1.54E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 3.16E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 5.91E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 2.56E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 1.01E-08 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 2.27E-07 NA mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 3.49E-13 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 6.59E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 2.55E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 9.69E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204148254 NA 2.98E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251