\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204079627:

Variant ID: vg0204079627 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4079627
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, T: 0.24, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATCTGGAATGAGATGCACAAATAGGTCTACATAAAATTCAACTACTCCAGAAAATTGCAGAAATTGATGTGTACAATGGGGTATCCAGGTATATTG[G/T]
TAAAATACAATAATCCTACATATCTGAAGTTATAAGTGAAACCATCCGCAATAAGTCAGCAACAGATGTATTCAGGAAAAAAAATCAGCAACAGATTATT

Reverse complement sequence

AATAATCTGTTGCTGATTTTTTTTCCTGAATACATCTGTTGCTGACTTATTGCGGATGGTTTCACTTATAACTTCAGATATGTAGGATTATTGTATTTTA[C/A]
CAATATACCTGGATACCCCATTGTACACATCAATTTCTGCAATTTTCTGGAGTAGTTGAATTTTATGTAGACCTATTTGTGCATCTCATTCCAGATTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 36.70% 0.04% 0.00% NA
All Indica  2759 74.10% 25.80% 0.07% 0.00% NA
All Japonica  1512 41.40% 58.60% 0.00% 0.00% NA
Aus  269 63.20% 36.80% 0.00% 0.00% NA
Indica I  595 74.50% 25.50% 0.00% 0.00% NA
Indica II  465 73.50% 26.50% 0.00% 0.00% NA
Indica III  913 74.00% 26.00% 0.00% 0.00% NA
Indica Intermediate  786 74.20% 25.60% 0.25% 0.00% NA
Temperate Japonica  767 9.00% 91.00% 0.00% 0.00% NA
Tropical Japonica  504 88.70% 11.30% 0.00% 0.00% NA
Japonica Intermediate  241 45.60% 54.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204079627 G -> T LOC_Os02g07800.1 upstream_gene_variant ; 3396.0bp to feature; MODIFIER silent_mutation Average:54.805; most accessible tissue: Callus, score: 67.643 N N N N
vg0204079627 G -> T LOC_Os02g07780.1 downstream_gene_variant ; 1678.0bp to feature; MODIFIER silent_mutation Average:54.805; most accessible tissue: Callus, score: 67.643 N N N N
vg0204079627 G -> T LOC_Os02g07780.2 downstream_gene_variant ; 1678.0bp to feature; MODIFIER silent_mutation Average:54.805; most accessible tissue: Callus, score: 67.643 N N N N
vg0204079627 G -> T LOC_Os02g07790.1 intron_variant ; MODIFIER silent_mutation Average:54.805; most accessible tissue: Callus, score: 67.643 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204079627 NA 4.11E-07 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 1.18E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 1.81E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 7.96E-12 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 2.39E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 8.75E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 2.94E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 6.73E-12 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 3.08E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 1.36E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 9.00E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 2.48E-11 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 2.25E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 3.99E-06 mr1607_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 4.15E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 6.75E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 7.54E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 4.11E-10 mr1942_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627 NA 1.07E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251