Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204079627:

Variant ID: vg0204079627 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 4079627
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, T: 0.24, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAATCTGGAATGAGATGCACAAATAGGTCTACATAAAATTCAACTACTCCAGAAAATTGCAGAAATTGATGTGTACAATGGGGTATCCAGGTATATTG[G/T]
TAAAATACAATAATCCTACATATCTGAAGTTATAAGTGAAACCATCCGCAATAAGTCAGCAACAGATGTATTCAGGAAAAAAAATCAGCAACAGATTATT

Reverse complement sequence

AATAATCTGTTGCTGATTTTTTTTCCTGAATACATCTGTTGCTGACTTATTGCGGATGGTTTCACTTATAACTTCAGATATGTAGGATTATTGTATTTTA[C/A]
CAATATACCTGGATACCCCATTGTACACATCAATTTCTGCAATTTTCTGGAGTAGTTGAATTTTATGTAGACCTATTTGTGCATCTCATTCCAGATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.30%	36.70%	0.04%	0.00%	NA
All Indica	2759	74.10%	25.80%	0.07%	0.00%	NA
All Japonica	1512	41.40%	58.60%	0.00%	0.00%	NA
Aus	269	63.20%	36.80%	0.00%	0.00%	NA
Indica I	595	74.50%	25.50%	0.00%	0.00%	NA
Indica II	465	73.50%	26.50%	0.00%	0.00%	NA
Indica III	913	74.00%	26.00%	0.00%	0.00%	NA
Indica Intermediate	786	74.20%	25.60%	0.25%	0.00%	NA
Temperate Japonica	767	9.00%	91.00%	0.00%	0.00%	NA
Tropical Japonica	504	88.70%	11.30%	0.00%	0.00%	NA
Japonica Intermediate	241	45.60%	54.40%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204079627	G -> T	LOC_Os02g07800.1	upstream_gene_variant ; 3396.0bp to feature; MODIFIER	silent_mutation	Average:54.805; most accessible tissue: Callus, score: 67.643	N	N	N	N
vg0204079627	G -> T	LOC_Os02g07780.1	downstream_gene_variant ; 1678.0bp to feature; MODIFIER	silent_mutation	Average:54.805; most accessible tissue: Callus, score: 67.643	N	N	N	N
vg0204079627	G -> T	LOC_Os02g07780.2	downstream_gene_variant ; 1678.0bp to feature; MODIFIER	silent_mutation	Average:54.805; most accessible tissue: Callus, score: 67.643	N	N	N	N
vg0204079627	G -> T	LOC_Os02g07790.1	intron_variant ; MODIFIER	silent_mutation	Average:54.805; most accessible tissue: Callus, score: 67.643	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204079627	NA	4.11E-07	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	1.18E-09	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	1.81E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	7.96E-12	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	2.39E-06	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	8.75E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	2.94E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	6.73E-12	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	3.08E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	1.36E-10	mr1552_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	9.00E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	2.48E-11	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	2.25E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	3.99E-06	mr1607_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	4.15E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	6.75E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	7.54E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	4.11E-10	mr1942_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204079627	NA	1.07E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251