Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204065908:

Variant ID: vg0204065908 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 4065908
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGTTCTCGCAAAAGATAATGGCCAACAGTCCTTATCCTGTAGCCAAAATAACCTTGTTTTGTCTTTTTCATGGATGCAGAGAGAAAAGACAGCACTA[C/T]
CGTATCGAAGTCAACTAATCTATTTTAAGACAGGCATCAAAATCTAATGACGCTATTTCTGATAAATTTCAGAGCCTTTATACTGATACATATGCTGCTT

Reverse complement sequence

AAGCAGCATATGTATCAGTATAAAGGCTCTGAAATTTATCAGAAATAGCGTCATTAGATTTTGATGCCTGTCTTAAAATAGATTAGTTGACTTCGATACG[G/A]
TAGTGCTGTCTTTTCTCTCTGCATCCATGAAAAAGACAAAACAAGGTTATTTTGGCTACAGGATAAGGACTGTTGGCCATTATCTTTTGCGAGAACAAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 40.20% 0.13% 0.00% NA
All Indica  2759 69.70% 30.20% 0.14% 0.00% NA
All Japonica  1512 41.50% 58.50% 0.00% 0.00% NA
Aus  269 44.20% 55.80% 0.00% 0.00% NA
Indica I  595 66.90% 33.10% 0.00% 0.00% NA
Indica II  465 78.50% 21.30% 0.22% 0.00% NA
Indica III  913 67.30% 32.70% 0.00% 0.00% NA
Indica Intermediate  786 69.50% 30.20% 0.38% 0.00% NA
Temperate Japonica  767 9.10% 90.90% 0.00% 0.00% NA
Tropical Japonica  504 88.70% 11.30% 0.00% 0.00% NA
Japonica Intermediate  241 45.60% 54.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 64.40% 33.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0204065908 C -> T LOC_Os02g07770-LOC_Os02g07780 intergenic_region ; MODIFIER silent_mutation Average:42.01; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0204065908 NA 1.69E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 1.71E-08 mr1826 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 1.60E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 2.16E-09 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 3.40E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 1.38E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 1.67E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 2.09E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 3.29E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 7.08E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 6.97E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 1.29E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 4.14E-12 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 2.79E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 4.08E-11 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 6.19E-11 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 3.77E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 3.20E-10 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 5.54E-15 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 1.57E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 1.76E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 5.48E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204065908 NA 1.08E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251