Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0204029963:

Variant ID: vg0204029963 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 4029963
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.26, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGACCATTTATTATAAACATAAGCTAAATTGACAATCGTCGAGACTATTTCGGCACTCTTTCCTACCCATCTCTATCGTTTTCTGCGCGCACGCTTTT[T/C]
AAACTACTAAATGTAACTTTTTTAAAAAAAAATTATATACGAAAGTTACTTTAAAAATTGTACTGATCTATTTTTTTAAAAAAAGCTAATACTTAATTAA

Reverse complement sequence

TTAATTAAGTATTAGCTTTTTTTAAAAAAATAGATCAGTACAATTTTTAAAGTAACTTTCGTATATAATTTTTTTTTAAAAAAGTTACATTTAGTAGTTT[A/G]
AAAAGCGTGCGCGCAGAAAACGATAGAGATGGGTAGGAAAGAGTGCCGAAATAGTCTCGACGATTGTCAATTTAGCTTATGTTTATAATAAATGGTCTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.00%	18.00%	0.06%	0.00%	NA
All Indica	2759	99.20%	0.80%	0.00%	0.00%	NA
All Japonica	1512	46.60%	53.20%	0.20%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.60%	0.40%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	12.90%	86.70%	0.39%	0.00%	NA
Tropical Japonica	504	88.50%	11.50%	0.00%	0.00%	NA
Japonica Intermediate	241	66.00%	34.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0204029963	T -> C	LOC_Os02g07730.1	upstream_gene_variant ; 966.0bp to feature; MODIFIER	silent_mutation	Average:92.398; most accessible tissue: Callus, score: 97.637	N	N	N	N
vg0204029963	T -> C	LOC_Os02g07740.1	upstream_gene_variant ; 4259.0bp to feature; MODIFIER	silent_mutation	Average:92.398; most accessible tissue: Callus, score: 97.637	N	N	N	N
vg0204029963	T -> C	LOC_Os02g07720.2	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:92.398; most accessible tissue: Callus, score: 97.637	N	N	N	N
vg0204029963	T -> C	LOC_Os02g07720.3	downstream_gene_variant ; 2133.0bp to feature; MODIFIER	silent_mutation	Average:92.398; most accessible tissue: Callus, score: 97.637	N	N	N	N
vg0204029963	T -> C	LOC_Os02g07720-LOC_Os02g07730	intergenic_region ; MODIFIER	silent_mutation	Average:92.398; most accessible tissue: Callus, score: 97.637	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0204029963	T	C	-0.02	-0.01	-0.01	-0.02	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0204029963	NA	5.99E-22	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	3.61E-30	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	8.99E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	2.44E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	2.50E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	1.44E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	1.21E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	1.35E-22	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	1.01E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	2.44E-32	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	1.27E-12	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	1.24E-13	mr1530_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0204029963	NA	2.24E-06	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251