\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203994446:

Variant ID: vg0203994446 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3994446
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.85, G: 0.15, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGGGGGGGGGGCCCTAAAAGTGTTCTAGCTGTAAGCATTTATGAGAAACATTCGTTCACTAACCTATGTCATTTTCTCCAACTAAGGAAATGTAAACA[G/A]
TATTTACTCGGCCAATCGCATGAGAACAATTGAAAGAAAAAAGGACCTTAGTGGAGGCCTGCGTGGTCATCGCCGCCGCGCACCCGTCGCCGACGGCCAC

Reverse complement sequence

GTGGCCGTCGGCGACGGGTGCGCGGCGGCGATGACCACGCAGGCCTCCACTAAGGTCCTTTTTTCTTTCAATTGTTCTCATGCGATTGGCCGAGTAAATA[C/T]
TGTTTACATTTCCTTAGTTGGAGAAAATGACATAGGTTAGTGAACGAATGTTTCTCATAAATGCTTACAGCTAGAACACTTTTAGGGCCCCCCCCCCCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 14.40% 0.04% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 56.80% 43.10% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 25.70% 74.10% 0.26% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 70.50% 29.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203994446 G -> A LOC_Os02g07670.3 3_prime_UTR_variant ; 48.0bp to feature; MODIFIER silent_mutation Average:82.441; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0203994446 G -> A LOC_Os02g07680.1 upstream_gene_variant ; 1703.0bp to feature; MODIFIER silent_mutation Average:82.441; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0203994446 G -> A LOC_Os02g07680.2 upstream_gene_variant ; 1534.0bp to feature; MODIFIER silent_mutation Average:82.441; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0203994446 G -> A LOC_Os02g07680.4 upstream_gene_variant ; 1534.0bp to feature; MODIFIER silent_mutation Average:82.441; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0203994446 G -> A LOC_Os02g07680.5 upstream_gene_variant ; 1534.0bp to feature; MODIFIER silent_mutation Average:82.441; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0203994446 G -> A LOC_Os02g07680.3 upstream_gene_variant ; 1681.0bp to feature; MODIFIER silent_mutation Average:82.441; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0203994446 G -> A LOC_Os02g07670.1 intron_variant ; MODIFIER silent_mutation Average:82.441; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0203994446 G -> A LOC_Os02g07670.2 intron_variant ; MODIFIER silent_mutation Average:82.441; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N
vg0203994446 G -> A LOC_Os02g07670.4 intron_variant ; MODIFIER silent_mutation Average:82.441; most accessible tissue: Zhenshan97 flag leaf, score: 88.918 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0203994446 G A -0.03 -0.04 -0.04 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203994446 NA 5.96E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203994446 NA 2.45E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203994446 NA 1.46E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 1.15E-12 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 1.83E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 3.37E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 3.37E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 2.00E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 1.50E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 3.07E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 6.74E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 1.10E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 3.65E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 5.43E-15 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 6.25E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 8.33E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 6.61E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 8.51E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 8.01E-09 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 1.29E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 2.11E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 9.65E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 3.17E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 6.39E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 3.56E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 5.87E-09 8.05E-33 mr1768_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 4.83E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 2.12E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 1.07E-09 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 4.76E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 4.99E-07 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203994446 NA 4.89E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251