\
| Variant ID: vg0203899414 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 3899414 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTGCTCTTCCCGGGTACTCTTGTCTTCCTCCAGTGTACCAAGATACTTGGAACTCTCTTCCAATCGGAGATGAAGCAGTACAAGCCTTGGAGTTGTTGGA[C/T]
CGTATGTTAAATCTTAAAGAACAAGGTTTACAGGGAGAGCAGATCACTCGGCACTTCATCAAATGCCGACTGGCGCCAATCAAGGAAAGATCCCGCACAG
CTGTGCGGGATCTTTCCTTGATTGGCGCCAGTCGGCATTTGATGAAGTGCCGAGTGATCTGCTCTCCCTGTAAACCTTGTTCTTTAAGATTTAACATACG[G/A]
TCCAACAACTCCAAGGCTTGTACTGCTTCATCTCCGATTGGAAGAGAGTTCCAAGTATCTTGGTACACTGGAGGAAGACAAGAGTACCCGGGAAGAGCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 13.60% | 1.10% | 22.28% | 63.10% | NA |
| All Indica | 2759 | 2.40% | 1.70% | 22.36% | 73.58% | NA |
| All Japonica | 1512 | 36.70% | 0.00% | 20.50% | 42.79% | NA |
| Aus | 269 | 0.70% | 0.00% | 9.29% | 89.96% | NA |
| Indica I | 595 | 1.70% | 2.70% | 20.34% | 75.29% | NA |
| Indica II | 465 | 5.80% | 1.90% | 16.13% | 76.13% | NA |
| Indica III | 913 | 0.70% | 0.70% | 26.51% | 72.18% | NA |
| Indica Intermediate | 786 | 2.80% | 2.00% | 22.77% | 72.39% | NA |
| Temperate Japonica | 767 | 63.10% | 0.00% | 6.91% | 29.99% | NA |
| Tropical Japonica | 504 | 3.20% | 0.00% | 31.35% | 65.48% | NA |
| Japonica Intermediate | 241 | 22.80% | 0.00% | 41.08% | 36.10% | NA |
| VI/Aromatic | 96 | 0.00% | 2.10% | 83.33% | 14.58% | NA |
| Intermediate | 90 | 21.10% | 1.10% | 23.33% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0203899414 | C -> T | LOC_Os02g07530.1 | synonymous_variant ; p.Asp206Asp; LOW | synonymous_codon | Average:6.368; most accessible tissue: Minghui63 flower, score: 11.139 | N | N | N | N |
| vg0203899414 | C -> DEL | LOC_Os02g07530.1 | N | frameshift_variant | Average:6.368; most accessible tissue: Minghui63 flower, score: 11.139 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0203899414 | 6.44E-08 | NA | Grain_weight | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0203899414 | NA | 2.13E-11 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0203899414 | NA | 9.40E-17 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0203899414 | NA | 2.43E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0203899414 | NA | 2.30E-21 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 1.72E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 1.25E-06 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 1.15E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 1.15E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 1.76E-06 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 4.38E-08 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 7.55E-06 | mr1446_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 1.39E-08 | mr1471_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 4.29E-11 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 1.67E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 2.99E-12 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203899414 | NA | 1.00E-06 | mr1722_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |