Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203895649:

Variant ID: vg0203895649 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3895649
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.15, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

CAAAGCTCGCCTTCGAATGTATGAGCGTGCCAGTTGATTTGATCCTGTAATCAACAAGAAATAGAGACAAAGAATTCGTGGTTAAATCTATAAATGATAG[T/C,A]
CGATCGGTAAGGTGCTGATGACATATCATTTATCTTTGAGCCGATGTCATATATGAATCGATCGGCGGTTATAAATAGATATTAAGGAACTAAATCTATT

Reverse complement sequence

AATAGATTTAGTTCCTTAATATCTATTTATAACCGCCGATCGATTCATATATGACATCGGCTCAAAGATAAATGATATGTCATCAGCACCTTACCGATCG[A/G,T]
CTATCATTTATAGATTTAACCACGAATTCTTTGTCTCTATTTCTTGTTGATTACAGGATCAAATCAACTGGCACGCTCATACATTCGAAGGCGAGCTTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.10%	12.20%	27.06%	1.67%	NA
All Indica	2759	58.20%	0.60%	38.42%	2.75%	NA
All Japonica	1512	64.20%	35.80%	0.00%	0.00%	NA
Aus	269	24.50%	0.00%	75.46%	0.00%	NA
Indica I	595	53.90%	0.30%	40.34%	5.38%	NA
Indica II	465	40.20%	1.10%	55.05%	3.66%	NA
Indica III	913	76.70%	0.30%	23.00%	0.00%	NA
Indica Intermediate	786	50.80%	0.80%	45.04%	3.44%	NA
Temperate Japonica	767	37.70%	62.30%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.20%	0.00%	0.00%	NA
Japonica Intermediate	241	78.00%	22.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	58.90%	21.10%	16.67%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203895649	T -> A	LOC_Os02g07520.1	upstream_gene_variant ; 207.0bp to feature; MODIFIER	N	Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0203895649	T -> A	LOC_Os02g07530.1	upstream_gene_variant ; 3148.0bp to feature; MODIFIER	N	Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0203895649	T -> A	LOC_Os02g07520-LOC_Os02g07530	intergenic_region ; MODIFIER	N	Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0203895649	T -> DEL	N	N	silent_mutation	Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0203895649	T -> C	LOC_Os02g07520.1	upstream_gene_variant ; 207.0bp to feature; MODIFIER	silent_mutation	Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0203895649	T -> C	LOC_Os02g07530.1	upstream_gene_variant ; 3148.0bp to feature; MODIFIER	silent_mutation	Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg0203895649	T -> C	LOC_Os02g07520-LOC_Os02g07530	intergenic_region ; MODIFIER	silent_mutation	Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0203895649	NA	1.69E-14	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203895649	NA	9.62E-15	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203895649	NA	2.12E-13	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203895649	NA	5.05E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	4.96E-06	mr1092	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	2.72E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	7.70E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	4.12E-08	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	9.03E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	1.86E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	3.17E-09	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	1.20E-07	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	7.84E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	1.27E-07	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	3.26E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	7.45E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	7.75E-07	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	1.43E-06	5.79E-09	mr1704	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	8.07E-08	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	1.81E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	7.64E-06	1.52E-07	mr1910	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	4.88E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	3.29E-11	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	4.03E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649	NA	7.02E-06	mr1851_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251