\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203895649:

Variant ID: vg0203895649 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3895649
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, T: 0.15, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAGCTCGCCTTCGAATGTATGAGCGTGCCAGTTGATTTGATCCTGTAATCAACAAGAAATAGAGACAAAGAATTCGTGGTTAAATCTATAAATGATAG[T/C,A]
CGATCGGTAAGGTGCTGATGACATATCATTTATCTTTGAGCCGATGTCATATATGAATCGATCGGCGGTTATAAATAGATATTAAGGAACTAAATCTATT

Reverse complement sequence

AATAGATTTAGTTCCTTAATATCTATTTATAACCGCCGATCGATTCATATATGACATCGGCTCAAAGATAAATGATATGTCATCAGCACCTTACCGATCG[A/G,T]
CTATCATTTATAGATTTAACCACGAATTCTTTGTCTCTATTTCTTGTTGATTACAGGATCAAATCAACTGGCACGCTCATACATTCGAAGGCGAGCTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 12.20% 27.06% 1.67% NA
All Indica  2759 58.20% 0.60% 38.42% 2.75% NA
All Japonica  1512 64.20% 35.80% 0.00% 0.00% NA
Aus  269 24.50% 0.00% 75.46% 0.00% NA
Indica I  595 53.90% 0.30% 40.34% 5.38% NA
Indica II  465 40.20% 1.10% 55.05% 3.66% NA
Indica III  913 76.70% 0.30% 23.00% 0.00% NA
Indica Intermediate  786 50.80% 0.80% 45.04% 3.44% NA
Temperate Japonica  767 37.70% 62.30% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 78.00% 22.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 58.90% 21.10% 16.67% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203895649 T -> A LOC_Os02g07520.1 upstream_gene_variant ; 207.0bp to feature; MODIFIER N Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0203895649 T -> A LOC_Os02g07530.1 upstream_gene_variant ; 3148.0bp to feature; MODIFIER N Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0203895649 T -> A LOC_Os02g07520-LOC_Os02g07530 intergenic_region ; MODIFIER N Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0203895649 T -> DEL N N silent_mutation Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0203895649 T -> C LOC_Os02g07520.1 upstream_gene_variant ; 207.0bp to feature; MODIFIER silent_mutation Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0203895649 T -> C LOC_Os02g07530.1 upstream_gene_variant ; 3148.0bp to feature; MODIFIER silent_mutation Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0203895649 T -> C LOC_Os02g07520-LOC_Os02g07530 intergenic_region ; MODIFIER silent_mutation Average:17.915; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203895649 NA 1.69E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203895649 NA 9.62E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203895649 NA 2.12E-13 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0203895649 NA 5.05E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 4.96E-06 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 2.72E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 7.70E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 4.12E-08 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 9.03E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 1.86E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 3.17E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 1.20E-07 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 7.84E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 1.27E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 3.26E-06 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 7.45E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 7.75E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 1.43E-06 5.79E-09 mr1704 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 8.07E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 1.81E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 7.64E-06 1.52E-07 mr1910 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 4.88E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 3.29E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 4.03E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203895649 NA 7.02E-06 mr1851_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251