\
| Variant ID: vg0203808446 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 3808446 |
| Reference Allele: C | Alternative Allele: T,CGA,CAA |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGAGACCTACCCCCCTTACAGTGGGTAGTCTTACTTTCGCCTGACTGAGAACCTTTGAACTGTTGTCCTTGAAAAAATGACCAACATTTCTCGGATTTA[C/T,CGA,CAA]
AGATGCCCTGACTTTGAAGACTAAAACTTCATCGGTCCATCAAATTGAAGCAATGGCGATGCACTTTCATCCCGACAAGATTTGGAACTTAAGCCTTAGT
ACTAAGGCTTAAGTTCCAAATCTTGTCGGGATGAAAGTGCATCGCCATTGCTTCAATTTGATGGACCGATGAAGTTTTAGTCTTCAAAGTCAGGGCATCT[G/A,TCG,TTG]
TAAATCCGAGAAATGTTGGTCATTTTTTCAAGGACAACAGTTCAAAGGTTCTCAGTCAGGCGAAAGTAAGACTACCCACTGTAAGGGGGGTAGGTCTCGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 9.30% | 3.64% | 21.63% | CGA: 1.29%; CAA: 0.08% |
| All Indica | 2759 | 68.90% | 15.50% | 5.69% | 7.79% | CGA: 1.99%; CAA: 0.11% |
| All Japonica | 1512 | 56.70% | 0.20% | 0.13% | 42.99% | NA |
| Aus | 269 | 41.60% | 0.00% | 3.35% | 53.16% | CGA: 1.49%; CAA: 0.37% |
| Indica I | 595 | 78.20% | 6.20% | 5.71% | 5.71% | CGA: 4.03%; CAA: 0.17% |
| Indica II | 465 | 64.50% | 4.30% | 11.18% | 16.56% | CGA: 3.23%; CAA: 0.22% |
| Indica III | 913 | 62.00% | 29.50% | 2.74% | 5.70% | CGA: 0.11% |
| Indica Intermediate | 786 | 72.50% | 13.00% | 5.85% | 6.62% | CGA: 1.91%; CAA: 0.13% |
| Temperate Japonica | 767 | 71.10% | 0.00% | 0.00% | 28.94% | NA |
| Tropical Japonica | 504 | 43.10% | 0.40% | 0.20% | 56.35% | NA |
| Japonica Intermediate | 241 | 39.40% | 0.40% | 0.41% | 59.75% | NA |
| VI/Aromatic | 96 | 89.60% | 3.10% | 1.04% | 6.25% | NA |
| Intermediate | 90 | 80.00% | 5.60% | 3.33% | 8.89% | CGA: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0203808446 | C -> T | LOC_Os02g07380.1 | upstream_gene_variant ; 2811.0bp to feature; MODIFIER | silent_mutation | Average:28.499; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg0203808446 | C -> T | LOC_Os02g07370.1 | downstream_gene_variant ; 1907.0bp to feature; MODIFIER | silent_mutation | Average:28.499; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg0203808446 | C -> T | LOC_Os02g07370-LOC_Os02g07380 | intergenic_region ; MODIFIER | silent_mutation | Average:28.499; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg0203808446 | C -> DEL | N | N | silent_mutation | Average:28.499; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg0203808446 | C -> CGA | LOC_Os02g07380.1 | upstream_gene_variant ; 2810.0bp to feature; MODIFIER | silent_mutation | Average:28.499; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg0203808446 | C -> CGA | LOC_Os02g07370.1 | downstream_gene_variant ; 1908.0bp to feature; MODIFIER | silent_mutation | Average:28.499; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg0203808446 | C -> CGA | LOC_Os02g07370-LOC_Os02g07380 | intergenic_region ; MODIFIER | silent_mutation | Average:28.499; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg0203808446 | C -> CAA | LOC_Os02g07380.1 | upstream_gene_variant ; 2810.0bp to feature; MODIFIER | silent_mutation | Average:28.499; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg0203808446 | C -> CAA | LOC_Os02g07370.1 | downstream_gene_variant ; 1908.0bp to feature; MODIFIER | silent_mutation | Average:28.499; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg0203808446 | C -> CAA | LOC_Os02g07370-LOC_Os02g07380 | intergenic_region ; MODIFIER | silent_mutation | Average:28.499; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0203808446 | 4.10E-06 | 4.10E-06 | mr1499 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |