\
| Variant ID: vg0203685324 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 3685324 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 112. )
GCGAATCTTTTGAGCCTAATTAGTTCATGATTAGCCATGAGTGCTACAGTAACACACATACGTTAATGACGGATTAACTAGGCTCAAAAGATTTGTCTCG[T/C]
GGTTTCCAGGCGAGTTATGAAATTAGTTTTTTTATTCGTGTCCGAAAACCCCTTCCGACATCCGGTCAAACGTTCGATGTGACATCCAAAATTTTTTTTT
AAAAAAAAATTTTGGATGTCACATCGAACGTTTGACCGGATGTCGGAAGGGGTTTTCGGACACGAATAAAAAAACTAATTTCATAACTCGCCTGGAAACC[A/G]
CGAGACAAATCTTTTGAGCCTAGTTAATCCGTCATTAACGTATGTGTGTTACTGTAGCACTCATGGCTAATCATGAACTAATTAGGCTCAAAAGATTCGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 12.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 62.70% | 37.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 36.50% | 63.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.00% | 26.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 17.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0203685324 | T -> C | LOC_Os02g07170.1 | upstream_gene_variant ; 1198.0bp to feature; MODIFIER | silent_mutation | Average:60.688; most accessible tissue: Zhenshan97 root, score: 84.358 | N | N | N | N |
| vg0203685324 | T -> C | LOC_Os02g07180.1 | upstream_gene_variant ; 2595.0bp to feature; MODIFIER | silent_mutation | Average:60.688; most accessible tissue: Zhenshan97 root, score: 84.358 | N | N | N | N |
| vg0203685324 | T -> C | LOC_Os02g07170-LOC_Os02g07180 | intergenic_region ; MODIFIER | silent_mutation | Average:60.688; most accessible tissue: Zhenshan97 root, score: 84.358 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0203685324 | NA | 8.53E-17 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0203685324 | NA | 1.77E-16 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0203685324 | NA | 1.23E-14 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0203685324 | NA | 5.84E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 1.54E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 4.79E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 4.40E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 1.76E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 3.48E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 5.93E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 8.43E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 9.76E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 4.59E-11 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 3.63E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 4.86E-07 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 9.02E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | NA | 5.48E-06 | mr1892_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203685324 | 3.20E-06 | 3.18E-06 | mr1919_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |