\
| Variant ID: vg0203671161 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 3671161 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTCTTTTCTTTTCTTTTTTTTAAAAAAAAAATGGTTCGGAGATTTGAAAATATAGTGTGAGTGTGAGTTATAATCAACAAAAGTATTTCTAGTGGTAGA[C/T]
GGCGTACTCATCAACAGCAACATGTCCGTGGTGACTTCGTTAATCTCAAAATGTGTCGGTCCGGTTTCCCGGGTGCTCGTTGTGCATGGGTACGATCATA
TATGATCGTACCCATGCACAACGAGCACCCGGGAAACCGGACCGACACATTTTGAGATTAACGAAGTCACCACGGACATGTTGCTGTTGATGAGTACGCC[G/A]
TCTACCACTAGAAATACTTTTGTTGATTATAACTCACACTCACACTATATTTTCAAATCTCCGAACCATTTTTTTTTTAAAAAAAAGAAAAGAAAAGAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.90% | 2.90% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 91.30% | 8.30% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 76.00% | 22.80% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0203671161 | C -> T | LOC_Os02g07120.1 | upstream_gene_variant ; 1838.0bp to feature; MODIFIER | silent_mutation | Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 | N | N | N | N |
| vg0203671161 | C -> T | LOC_Os02g07130.1 | upstream_gene_variant ; 456.0bp to feature; MODIFIER | silent_mutation | Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 | N | N | N | N |
| vg0203671161 | C -> T | LOC_Os02g07150.1 | upstream_gene_variant ; 3512.0bp to feature; MODIFIER | silent_mutation | Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 | N | N | N | N |
| vg0203671161 | C -> T | LOC_Os02g07150.3 | upstream_gene_variant ; 3512.0bp to feature; MODIFIER | silent_mutation | Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 | N | N | N | N |
| vg0203671161 | C -> T | LOC_Os02g07140.1 | downstream_gene_variant ; 2154.0bp to feature; MODIFIER | silent_mutation | Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 | N | N | N | N |
| vg0203671161 | C -> T | LOC_Os02g07130-LOC_Os02g07140 | intergenic_region ; MODIFIER | silent_mutation | Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0203671161 | 1.57E-06 | 6.28E-09 | mr1125 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203671161 | NA | 8.41E-09 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203671161 | 4.00E-06 | 6.78E-11 | mr1188 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203671161 | 6.87E-09 | 1.38E-11 | mr1448 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203671161 | NA | 5.99E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203671161 | 5.08E-06 | 1.68E-10 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203671161 | NA | 2.43E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203671161 | 5.17E-06 | 7.09E-15 | mr1188_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |