\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203671161:

Variant ID: vg0203671161 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3671161
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCTTTTCTTTTCTTTTTTTTAAAAAAAAAATGGTTCGGAGATTTGAAAATATAGTGTGAGTGTGAGTTATAATCAACAAAAGTATTTCTAGTGGTAGA[C/T]
GGCGTACTCATCAACAGCAACATGTCCGTGGTGACTTCGTTAATCTCAAAATGTGTCGGTCCGGTTTCCCGGGTGCTCGTTGTGCATGGGTACGATCATA

Reverse complement sequence

TATGATCGTACCCATGCACAACGAGCACCCGGGAAACCGGACCGACACATTTTGAGATTAACGAAGTCACCACGGACATGTTGCTGTTGATGAGTACGCC[G/A]
TCTACCACTAGAAATACTTTTGTTGATTATAACTCACACTCACACTATATTTTCAAATCTCCGAACCATTTTTTTTTTAAAAAAAAGAAAAGAAAAGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 2.90% 0.17% 0.00% NA
All Indica  2759 99.80% 0.10% 0.07% 0.00% NA
All Japonica  1512 91.30% 8.30% 0.40% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 76.00% 22.80% 1.19% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203671161 C -> T LOC_Os02g07120.1 upstream_gene_variant ; 1838.0bp to feature; MODIFIER silent_mutation Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 N N N N
vg0203671161 C -> T LOC_Os02g07130.1 upstream_gene_variant ; 456.0bp to feature; MODIFIER silent_mutation Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 N N N N
vg0203671161 C -> T LOC_Os02g07150.1 upstream_gene_variant ; 3512.0bp to feature; MODIFIER silent_mutation Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 N N N N
vg0203671161 C -> T LOC_Os02g07150.3 upstream_gene_variant ; 3512.0bp to feature; MODIFIER silent_mutation Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 N N N N
vg0203671161 C -> T LOC_Os02g07140.1 downstream_gene_variant ; 2154.0bp to feature; MODIFIER silent_mutation Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 N N N N
vg0203671161 C -> T LOC_Os02g07130-LOC_Os02g07140 intergenic_region ; MODIFIER silent_mutation Average:52.779; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203671161 1.57E-06 6.28E-09 mr1125 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161 NA 8.41E-09 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161 4.00E-06 6.78E-11 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161 6.87E-09 1.38E-11 mr1448 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161 NA 5.99E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161 5.08E-06 1.68E-10 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161 NA 2.43E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203671161 5.17E-06 7.09E-15 mr1188_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251