\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203448916:

Variant ID: vg0203448916 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3448916
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CGCAGAACATACATACTAGGGATCAATCCAAATGGGATGTCTGCAAACTATGCAAATATGTACTGTGCAGATCTGCAATAAATCAAATTAGCACGATACA[A/G]
TAGACCATCAGATCTAGTGAACATAACTAAGAAAGAGCACACATATATCACGGTTCGCCATGAAGAGAAAGCATTAGCGCCTCCATCCCCAGATCCACGA

Reverse complement sequence

TCGTGGATCTGGGGATGGAGGCGCTAATGCTTTCTCTTCATGGCGAACCGTGATATATGTGTGCTCTTTCTTAGTTATGTTCACTAGATCTGATGGTCTA[T/C]
TGTATCGTGCTAATTTGATTTATTGCAGATCTGCACAGTACATATTTGCATAGTTTGCAGACATCCCATTTGGATTGATCCCTAGTATGTATGTTCTGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.10% 6.70% 0.59% 70.57% NA
All Indica  2759 3.00% 3.30% 0.62% 93.00% NA
All Japonica  1512 60.30% 0.10% 0.53% 39.09% NA
Aus  269 5.20% 79.90% 0.37% 14.50% NA
Indica I  595 5.50% 0.00% 0.67% 93.78% NA
Indica II  465 1.50% 0.40% 0.65% 97.42% NA
Indica III  913 1.50% 6.00% 0.22% 92.22% NA
Indica Intermediate  786 3.80% 4.50% 1.02% 90.71% NA
Temperate Japonica  767 69.50% 0.00% 0.91% 29.60% NA
Tropical Japonica  504 53.40% 0.20% 0.20% 46.23% NA
Japonica Intermediate  241 45.20% 0.40% 0.00% 54.36% NA
VI/Aromatic  96 4.20% 3.10% 0.00% 92.71% NA
Intermediate  90 34.40% 7.80% 2.22% 55.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203448916 A -> G LOC_Os02g06840.1 upstream_gene_variant ; 4555.0bp to feature; MODIFIER silent_mutation Average:14.844; most accessible tissue: Callus, score: 41.078 N N N N
vg0203448916 A -> G LOC_Os02g06840.2 upstream_gene_variant ; 4383.0bp to feature; MODIFIER silent_mutation Average:14.844; most accessible tissue: Callus, score: 41.078 N N N N
vg0203448916 A -> G LOC_Os02g06830.1 intron_variant ; MODIFIER silent_mutation Average:14.844; most accessible tissue: Callus, score: 41.078 N N N N
vg0203448916 A -> G LOC_Os02g06830.2 intron_variant ; MODIFIER silent_mutation Average:14.844; most accessible tissue: Callus, score: 41.078 N N N N
vg0203448916 A -> DEL N N silent_mutation Average:14.844; most accessible tissue: Callus, score: 41.078 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203448916 NA 1.20E-08 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 8.87E-06 8.87E-06 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 NA 3.31E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 NA 3.91E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 NA 8.29E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 NA 1.46E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 NA 3.19E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 NA 5.55E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 NA 4.27E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 NA 2.97E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 NA 8.27E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 2.07E-06 2.07E-06 mr1655_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 2.37E-06 2.37E-06 mr1669_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203448916 NA 7.46E-07 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251