Variant ID: vg0203433343 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 3433343 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 204. )
ACAATTTAGTGATATAAAAAAAGAATACTTAAAAGCACATGGCAAAATGCAGGGACAATAAGCTCACACTGAGAACTCGACAATTGATCTGGTGGACAAA[A/G]
TTAGAGCTGATGAAGAAGAACACAGAGATCAGGTTGTGGCCACAGAACCCCAGATGCAGGAAAATAGCAATCCAGAGACTGAAAGTAATCAGTTGATAAC
GTTATCAACTGATTACTTTCAGTCTCTGGATTGCTATTTTCCTGCATCTGGGGTTCTGTGGCCACAACCTGATCTCTGTGTTCTTCTTCATCAGCTCTAA[T/C]
TTTGTCCACCAGATCAATTGTCGAGTTCTCAGTGTGAGCTTATTGTCCCTGCATTTTGCCATGTGCTTTTAAGTATTCTTTTTTTATATCACTAAATTGT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 64.60% | 19.00% | 0.51% | 15.91% | NA |
All Indica | 2759 | 92.30% | 1.30% | 0.58% | 5.80% | NA |
All Japonica | 1512 | 14.60% | 54.70% | 0.20% | 30.49% | NA |
Aus | 269 | 84.80% | 5.20% | 0.37% | 9.67% | NA |
Indica I | 595 | 94.10% | 2.90% | 0.50% | 2.52% | NA |
Indica II | 465 | 91.40% | 0.00% | 0.22% | 8.39% | NA |
Indica III | 913 | 95.30% | 0.40% | 0.55% | 3.72% | NA |
Indica Intermediate | 786 | 87.90% | 2.00% | 0.89% | 9.16% | NA |
Temperate Japonica | 767 | 5.20% | 67.40% | 0.00% | 27.38% | NA |
Tropical Japonica | 504 | 23.00% | 44.80% | 0.40% | 31.75% | NA |
Japonica Intermediate | 241 | 27.00% | 34.90% | 0.41% | 37.76% | NA |
VI/Aromatic | 96 | 14.60% | 1.00% | 3.12% | 81.25% | NA |
Intermediate | 90 | 48.90% | 20.00% | 1.11% | 30.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0203433343 | A -> G | LOC_Os02g06790.1 | upstream_gene_variant ; 2268.0bp to feature; MODIFIER | silent_mutation | Average:25.075; most accessible tissue: Callus, score: 64.351 | N | N | N | N |
vg0203433343 | A -> G | LOC_Os02g06810.1 | downstream_gene_variant ; 972.0bp to feature; MODIFIER | silent_mutation | Average:25.075; most accessible tissue: Callus, score: 64.351 | N | N | N | N |
vg0203433343 | A -> G | LOC_Os02g06790-LOC_Os02g06810 | intergenic_region ; MODIFIER | silent_mutation | Average:25.075; most accessible tissue: Callus, score: 64.351 | N | N | N | N |
vg0203433343 | A -> DEL | N | N | silent_mutation | Average:25.075; most accessible tissue: Callus, score: 64.351 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0203433343 | NA | 4.18E-07 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | NA | 3.45E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | NA | 3.49E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | NA | 9.50E-07 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | NA | 5.43E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | NA | 2.59E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | NA | 4.03E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | NA | 1.38E-06 | mr1267_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | NA | 8.89E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | 8.24E-06 | 8.24E-06 | mr1655_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | 8.12E-07 | 8.12E-07 | mr1669_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203433343 | NA | 7.01E-07 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |