\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203433343:

Variant ID: vg0203433343 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3433343
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


ACAATTTAGTGATATAAAAAAAGAATACTTAAAAGCACATGGCAAAATGCAGGGACAATAAGCTCACACTGAGAACTCGACAATTGATCTGGTGGACAAA[A/G]
TTAGAGCTGATGAAGAAGAACACAGAGATCAGGTTGTGGCCACAGAACCCCAGATGCAGGAAAATAGCAATCCAGAGACTGAAAGTAATCAGTTGATAAC

Reverse complement sequence

GTTATCAACTGATTACTTTCAGTCTCTGGATTGCTATTTTCCTGCATCTGGGGTTCTGTGGCCACAACCTGATCTCTGTGTTCTTCTTCATCAGCTCTAA[T/C]
TTTGTCCACCAGATCAATTGTCGAGTTCTCAGTGTGAGCTTATTGTCCCTGCATTTTGCCATGTGCTTTTAAGTATTCTTTTTTTATATCACTAAATTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 19.00% 0.51% 15.91% NA
All Indica  2759 92.30% 1.30% 0.58% 5.80% NA
All Japonica  1512 14.60% 54.70% 0.20% 30.49% NA
Aus  269 84.80% 5.20% 0.37% 9.67% NA
Indica I  595 94.10% 2.90% 0.50% 2.52% NA
Indica II  465 91.40% 0.00% 0.22% 8.39% NA
Indica III  913 95.30% 0.40% 0.55% 3.72% NA
Indica Intermediate  786 87.90% 2.00% 0.89% 9.16% NA
Temperate Japonica  767 5.20% 67.40% 0.00% 27.38% NA
Tropical Japonica  504 23.00% 44.80% 0.40% 31.75% NA
Japonica Intermediate  241 27.00% 34.90% 0.41% 37.76% NA
VI/Aromatic  96 14.60% 1.00% 3.12% 81.25% NA
Intermediate  90 48.90% 20.00% 1.11% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203433343 A -> G LOC_Os02g06790.1 upstream_gene_variant ; 2268.0bp to feature; MODIFIER silent_mutation Average:25.075; most accessible tissue: Callus, score: 64.351 N N N N
vg0203433343 A -> G LOC_Os02g06810.1 downstream_gene_variant ; 972.0bp to feature; MODIFIER silent_mutation Average:25.075; most accessible tissue: Callus, score: 64.351 N N N N
vg0203433343 A -> G LOC_Os02g06790-LOC_Os02g06810 intergenic_region ; MODIFIER silent_mutation Average:25.075; most accessible tissue: Callus, score: 64.351 N N N N
vg0203433343 A -> DEL N N silent_mutation Average:25.075; most accessible tissue: Callus, score: 64.351 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203433343 NA 4.18E-07 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 NA 3.45E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 NA 3.49E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 NA 9.50E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 NA 5.43E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 NA 2.59E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 NA 4.03E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 NA 1.38E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 NA 8.89E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 8.24E-06 8.24E-06 mr1655_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 8.12E-07 8.12E-07 mr1669_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203433343 NA 7.01E-07 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251