\
| Variant ID: vg0203433301 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 3433301 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.06, others allele: 0.00, population size: 204. )
TTTCTTAATTTAATTAACTTAAAATATAAAAAAGTACATCACACAATTTAGTGATATAAAAAAAGAATACTTAAAAGCACATGGCAAAATGCAGGGACAA[T/C]
AAGCTCACACTGAGAACTCGACAATTGATCTGGTGGACAAAATTAGAGCTGATGAAGAAGAACACAGAGATCAGGTTGTGGCCACAGAACCCCAGATGCA
TGCATCTGGGGTTCTGTGGCCACAACCTGATCTCTGTGTTCTTCTTCATCAGCTCTAATTTTGTCCACCAGATCAATTGTCGAGTTCTCAGTGTGAGCTT[A/G]
TTGTCCCTGCATTTTGCCATGTGCTTTTAAGTATTCTTTTTTTATATCACTAAATTGTGTGATGTACTTTTTTATATTTTAAGTTAATTAAATTAAGAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.70% | 19.00% | 0.55% | 15.76% | NA |
| All Indica | 2759 | 92.40% | 1.30% | 0.62% | 5.73% | NA |
| All Japonica | 1512 | 14.70% | 54.70% | 0.33% | 30.22% | NA |
| Aus | 269 | 85.10% | 5.20% | 0.37% | 9.29% | NA |
| Indica I | 595 | 94.50% | 2.70% | 0.50% | 2.35% | NA |
| Indica II | 465 | 91.20% | 0.00% | 0.22% | 8.60% | NA |
| Indica III | 913 | 95.40% | 0.40% | 0.44% | 3.72% | NA |
| Indica Intermediate | 786 | 87.90% | 2.00% | 1.15% | 8.91% | NA |
| Temperate Japonica | 767 | 5.30% | 67.40% | 0.13% | 27.12% | NA |
| Tropical Japonica | 504 | 23.20% | 44.80% | 0.60% | 31.35% | NA |
| Japonica Intermediate | 241 | 27.00% | 34.90% | 0.41% | 37.76% | NA |
| VI/Aromatic | 96 | 15.60% | 2.10% | 2.08% | 80.21% | NA |
| Intermediate | 90 | 46.70% | 21.10% | 1.11% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0203433301 | T -> DEL | N | N | silent_mutation | Average:26.129; most accessible tissue: Callus, score: 79.861 | N | N | N | N |
| vg0203433301 | T -> C | LOC_Os02g06790.1 | upstream_gene_variant ; 2226.0bp to feature; MODIFIER | silent_mutation | Average:26.129; most accessible tissue: Callus, score: 79.861 | N | N | N | N |
| vg0203433301 | T -> C | LOC_Os02g06810.1 | downstream_gene_variant ; 1014.0bp to feature; MODIFIER | silent_mutation | Average:26.129; most accessible tissue: Callus, score: 79.861 | N | N | N | N |
| vg0203433301 | T -> C | LOC_Os02g06790-LOC_Os02g06810 | intergenic_region ; MODIFIER | silent_mutation | Average:26.129; most accessible tissue: Callus, score: 79.861 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0203433301 | NA | 6.61E-07 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 4.29E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 5.31E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 1.28E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 2.15E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 6.99E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 3.31E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 9.67E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 1.35E-12 | mr1258_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 1.93E-06 | mr1267_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 6.92E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | 7.60E-06 | 7.61E-06 | mr1655_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | 1.94E-06 | 1.94E-06 | mr1669_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 1.26E-06 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 7.21E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | 4.22E-07 | 2.93E-18 | mr1980_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203433301 | NA | 2.61E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |