Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0203428380:

Variant ID: vg0203428380 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3428380
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTGTTCAACCCTAACTTCCAACTTTCCATCACATCACATCACATCCAAAACTTTCCTACACACATAAACTTCCAATTTTTTTTCCAAACTTCCAACTTT[C/T]
CCCAAACTTCCAACTTTTTTCAGGAACTAAACACAGCCTTAGTCTTATTAATCTAAATATCAAGGCCGACAAAAAGGAAAAGAATTATTTGATTCCAAGC

Reverse complement sequence

GCTTGGAATCAAATAATTCTTTTCCTTTTTGTCGGCCTTGATATTTAGATTAATAAGACTAAGGCTGTGTTTAGTTCCTGAAAAAAGTTGGAAGTTTGGG[G/A]
AAAGTTGGAAGTTTGGAAAAAAAATTGGAAGTTTATGTGTGTAGGAAAGTTTTGGATGTGATGTGATGTGATGGAAAGTTGGAAGTTAGGGTTGAACACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.80%	2.70%	23.36%	36.16%	NA
All Indica	2759	20.70%	4.50%	38.42%	36.39%	NA
All Japonica	1512	61.80%	0.10%	1.52%	36.57%	NA
Aus	269	85.10%	0.00%	1.49%	13.38%	NA
Indica I	595	12.60%	4.20%	44.03%	39.16%	NA
Indica II	465	24.50%	0.40%	35.48%	39.57%	NA
Indica III	913	23.20%	8.80%	36.80%	31.22%	NA
Indica Intermediate	786	21.60%	2.20%	37.79%	38.42%	NA
Temperate Japonica	767	70.40%	0.00%	0.91%	28.68%	NA
Tropical Japonica	504	55.80%	0.20%	2.18%	41.87%	NA
Japonica Intermediate	241	47.30%	0.00%	2.07%	50.62%	NA
VI/Aromatic	96	6.20%	0.00%	1.04%	92.71%	NA
Intermediate	90	51.10%	1.10%	17.78%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203428380	C -> T	LOC_Os02g06779.1	upstream_gene_variant ; 4934.0bp to feature; MODIFIER	silent_mutation	Average:13.355; most accessible tissue: Callus, score: 58.161	N	N	N	N
vg0203428380	C -> T	LOC_Os02g06790.1	downstream_gene_variant ; 167.0bp to feature; MODIFIER	silent_mutation	Average:13.355; most accessible tissue: Callus, score: 58.161	N	N	N	N
vg0203428380	C -> T	LOC_Os02g06779-LOC_Os02g06790	intergenic_region ; MODIFIER	silent_mutation	Average:13.355; most accessible tissue: Callus, score: 58.161	N	N	N	N
vg0203428380	C -> DEL	N	N	silent_mutation	Average:13.355; most accessible tissue: Callus, score: 58.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0203428380	NA	5.34E-10	mr1201	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	NA	7.27E-11	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	NA	4.84E-07	mr1219	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	NA	4.14E-09	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	NA	3.17E-10	mr1274	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	NA	1.98E-09	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	7.49E-06	3.95E-14	mr1201_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	3.30E-06	3.38E-15	mr1201_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	NA	4.57E-09	mr1219_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	NA	2.17E-12	mr1219_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	NA	5.61E-14	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203428380	NA	5.83E-14	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251