Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203358788:

Variant ID: vg0203358788 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3358788
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAGGATGACAAACACGGCTAGCTTAGGTAGGATGCACGAGTTTTAGGACCTCAGAGAGAATGAATCACCTCCTAATGCTAGCTTAGGAATGACTAGTTC[T/C]
AGTACTTCATATAAAATGAAAAGGAAATGCTATTCTTCTGTTGACAGAAAATGCAGTGCCAAATGGATCAAAATTCAACTTTGCAGTATATCGCCAGAGG

Reverse complement sequence

CCTCTGGCGATATACTGCAAAGTTGAATTTTGATCCATTTGGCACTGCATTTTCTGTCAACAGAAGAATAGCATTTCCTTTTCATTTTATATGAAGTACT[A/G]
GAACTAGTCATTCCTAAGCTAGCATTAGGAGGTGATTCATTCTCTCTGAGGTCCTAAAACTCGTGCATCCTACCTAAGCTAGCCGTGTTTGTCATCCTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.70%	27.10%	0.11%	0.00%	NA
All Indica	2759	94.80%	5.10%	0.07%	0.00%	NA
All Japonica	1512	41.90%	57.90%	0.20%	0.00%	NA
Aus	269	14.90%	85.10%	0.00%	0.00%	NA
Indica I	595	95.10%	4.90%	0.00%	0.00%	NA
Indica II	465	98.50%	1.30%	0.22%	0.00%	NA
Indica III	913	92.90%	7.10%	0.00%	0.00%	NA
Indica Intermediate	786	94.50%	5.30%	0.13%	0.00%	NA
Temperate Japonica	767	33.50%	66.10%	0.39%	0.00%	NA
Tropical Japonica	504	48.00%	52.00%	0.00%	0.00%	NA
Japonica Intermediate	241	56.00%	44.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	60.00%	40.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203358788	T -> C	LOC_Os02g06670.1	downstream_gene_variant ; 3966.0bp to feature; MODIFIER	silent_mutation	Average:76.885; most accessible tissue: Callus, score: 92.575	N	N	N	N
vg0203358788	T -> C	LOC_Os02g06690.1	downstream_gene_variant ; 506.0bp to feature; MODIFIER	silent_mutation	Average:76.885; most accessible tissue: Callus, score: 92.575	N	N	N	N
vg0203358788	T -> C	LOC_Os02g06700.1	downstream_gene_variant ; 116.0bp to feature; MODIFIER	silent_mutation	Average:76.885; most accessible tissue: Callus, score: 92.575	N	N	N	N
vg0203358788	T -> C	LOC_Os02g06720.1	downstream_gene_variant ; 3259.0bp to feature; MODIFIER	silent_mutation	Average:76.885; most accessible tissue: Callus, score: 92.575	N	N	N	N
vg0203358788	T -> C	LOC_Os02g06700.2	downstream_gene_variant ; 115.0bp to feature; MODIFIER	silent_mutation	Average:76.885; most accessible tissue: Callus, score: 92.575	N	N	N	N
vg0203358788	T -> C	LOC_Os02g06690-LOC_Os02g06700	intergenic_region ; MODIFIER	silent_mutation	Average:76.885; most accessible tissue: Callus, score: 92.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0203358788	NA	6.49E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788	NA	6.12E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788	NA	8.20E-06	mr1267_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788	NA	7.48E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788	5.72E-06	4.70E-07	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788	3.19E-06	1.48E-08	mr1655_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788	1.70E-06	6.10E-06	mr1669_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788	5.35E-06	5.35E-06	mr1669_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788	NA	3.52E-06	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251