Variant ID: vg0203358788 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 3358788 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTAGGATGACAAACACGGCTAGCTTAGGTAGGATGCACGAGTTTTAGGACCTCAGAGAGAATGAATCACCTCCTAATGCTAGCTTAGGAATGACTAGTTC[T/C]
AGTACTTCATATAAAATGAAAAGGAAATGCTATTCTTCTGTTGACAGAAAATGCAGTGCCAAATGGATCAAAATTCAACTTTGCAGTATATCGCCAGAGG
CCTCTGGCGATATACTGCAAAGTTGAATTTTGATCCATTTGGCACTGCATTTTCTGTCAACAGAAGAATAGCATTTCCTTTTCATTTTATATGAAGTACT[A/G]
GAACTAGTCATTCCTAAGCTAGCATTAGGAGGTGATTCATTCTCTCTGAGGTCCTAAAACTCGTGCATCCTACCTAAGCTAGCCGTGTTTGTCATCCTAC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 72.70% | 27.10% | 0.11% | 0.00% | NA |
All Indica | 2759 | 94.80% | 5.10% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 41.90% | 57.90% | 0.20% | 0.00% | NA |
Aus | 269 | 14.90% | 85.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.50% | 1.30% | 0.22% | 0.00% | NA |
Indica III | 913 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 94.50% | 5.30% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 33.50% | 66.10% | 0.39% | 0.00% | NA |
Tropical Japonica | 504 | 48.00% | 52.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 56.00% | 44.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 60.00% | 40.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0203358788 | T -> C | LOC_Os02g06670.1 | downstream_gene_variant ; 3966.0bp to feature; MODIFIER | silent_mutation | Average:76.885; most accessible tissue: Callus, score: 92.575 | N | N | N | N |
vg0203358788 | T -> C | LOC_Os02g06690.1 | downstream_gene_variant ; 506.0bp to feature; MODIFIER | silent_mutation | Average:76.885; most accessible tissue: Callus, score: 92.575 | N | N | N | N |
vg0203358788 | T -> C | LOC_Os02g06700.1 | downstream_gene_variant ; 116.0bp to feature; MODIFIER | silent_mutation | Average:76.885; most accessible tissue: Callus, score: 92.575 | N | N | N | N |
vg0203358788 | T -> C | LOC_Os02g06720.1 | downstream_gene_variant ; 3259.0bp to feature; MODIFIER | silent_mutation | Average:76.885; most accessible tissue: Callus, score: 92.575 | N | N | N | N |
vg0203358788 | T -> C | LOC_Os02g06700.2 | downstream_gene_variant ; 115.0bp to feature; MODIFIER | silent_mutation | Average:76.885; most accessible tissue: Callus, score: 92.575 | N | N | N | N |
vg0203358788 | T -> C | LOC_Os02g06690-LOC_Os02g06700 | intergenic_region ; MODIFIER | silent_mutation | Average:76.885; most accessible tissue: Callus, score: 92.575 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0203358788 | NA | 6.49E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203358788 | NA | 6.12E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203358788 | NA | 8.20E-06 | mr1267_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203358788 | NA | 7.48E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203358788 | 5.72E-06 | 4.70E-07 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203358788 | 3.19E-06 | 1.48E-08 | mr1655_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203358788 | 1.70E-06 | 6.10E-06 | mr1669_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203358788 | 5.35E-06 | 5.35E-06 | mr1669_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203358788 | NA | 3.52E-06 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |