\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203358788:

Variant ID: vg0203358788 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3358788
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAGGATGACAAACACGGCTAGCTTAGGTAGGATGCACGAGTTTTAGGACCTCAGAGAGAATGAATCACCTCCTAATGCTAGCTTAGGAATGACTAGTTC[T/C]
AGTACTTCATATAAAATGAAAAGGAAATGCTATTCTTCTGTTGACAGAAAATGCAGTGCCAAATGGATCAAAATTCAACTTTGCAGTATATCGCCAGAGG

Reverse complement sequence

CCTCTGGCGATATACTGCAAAGTTGAATTTTGATCCATTTGGCACTGCATTTTCTGTCAACAGAAGAATAGCATTTCCTTTTCATTTTATATGAAGTACT[A/G]
GAACTAGTCATTCCTAAGCTAGCATTAGGAGGTGATTCATTCTCTCTGAGGTCCTAAAACTCGTGCATCCTACCTAAGCTAGCCGTGTTTGTCATCCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.70% 27.10% 0.11% 0.00% NA
All Indica  2759 94.80% 5.10% 0.07% 0.00% NA
All Japonica  1512 41.90% 57.90% 0.20% 0.00% NA
Aus  269 14.90% 85.10% 0.00% 0.00% NA
Indica I  595 95.10% 4.90% 0.00% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 92.90% 7.10% 0.00% 0.00% NA
Indica Intermediate  786 94.50% 5.30% 0.13% 0.00% NA
Temperate Japonica  767 33.50% 66.10% 0.39% 0.00% NA
Tropical Japonica  504 48.00% 52.00% 0.00% 0.00% NA
Japonica Intermediate  241 56.00% 44.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203358788 T -> C LOC_Os02g06670.1 downstream_gene_variant ; 3966.0bp to feature; MODIFIER silent_mutation Average:76.885; most accessible tissue: Callus, score: 92.575 N N N N
vg0203358788 T -> C LOC_Os02g06690.1 downstream_gene_variant ; 506.0bp to feature; MODIFIER silent_mutation Average:76.885; most accessible tissue: Callus, score: 92.575 N N N N
vg0203358788 T -> C LOC_Os02g06700.1 downstream_gene_variant ; 116.0bp to feature; MODIFIER silent_mutation Average:76.885; most accessible tissue: Callus, score: 92.575 N N N N
vg0203358788 T -> C LOC_Os02g06720.1 downstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:76.885; most accessible tissue: Callus, score: 92.575 N N N N
vg0203358788 T -> C LOC_Os02g06700.2 downstream_gene_variant ; 115.0bp to feature; MODIFIER silent_mutation Average:76.885; most accessible tissue: Callus, score: 92.575 N N N N
vg0203358788 T -> C LOC_Os02g06690-LOC_Os02g06700 intergenic_region ; MODIFIER silent_mutation Average:76.885; most accessible tissue: Callus, score: 92.575 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203358788 NA 6.49E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788 NA 6.12E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788 NA 8.20E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788 NA 7.48E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788 5.72E-06 4.70E-07 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788 3.19E-06 1.48E-08 mr1655_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788 1.70E-06 6.10E-06 mr1669_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788 5.35E-06 5.35E-06 mr1669_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203358788 NA 3.52E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251