Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203357479:

Variant ID: vg0203357479 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3357479
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

TTTATTGTCCCACATGTCGGTGTCTATAATAATAATGTCATTATGATAGAGAATATGAACTCATAAGGACAGACCCAGCCCTCGGCCCCTAGGTCATGGC[C/T]
CGGAGGCCTATGGCTGAACACCCATGTACCTTTTTTTTTTTTGCACCATGATGATAAAAAATTCAGTACACGTGCAACATTACAGTCACACTTTTGAGTC

Reverse complement sequence

GACTCAAAAGTGTGACTGTAATGTTGCACGTGTACTGAATTTTTTATCATCATGGTGCAAAAAAAAAAAAGGTACATGGGTGTTCAGCCATAGGCCTCCG[G/A]
GCCATGACCTAGGGGCCGAGGGCTGGGTCTGTCCTTATGAGTTCATATTCTCTATCATAATGACATTATTATTATAGACACCGACATGTGGGACAATAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	27.50%	0.60%	0.11%	71.79%	NA
All Indica	2759	5.80%	0.30%	0.07%	93.80%	NA
All Japonica	1512	58.70%	0.10%	0.07%	41.14%	NA
Aus	269	78.80%	6.30%	0.37%	14.50%	NA
Indica I	595	5.90%	0.00%	0.34%	93.78%	NA
Indica II	465	1.90%	0.00%	0.00%	98.06%	NA
Indica III	913	6.90%	0.70%	0.00%	92.44%	NA
Indica Intermediate	786	6.90%	0.30%	0.00%	92.88%	NA
Temperate Japonica	767	67.30%	0.00%	0.13%	32.59%	NA
Tropical Japonica	504	52.60%	0.00%	0.00%	47.42%	NA
Japonica Intermediate	241	44.40%	0.40%	0.00%	55.19%	NA
VI/Aromatic	96	4.20%	0.00%	1.04%	94.79%	NA
Intermediate	90	38.90%	2.20%	0.00%	58.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203357479	C -> T	LOC_Os02g06660.1	downstream_gene_variant ; 4869.0bp to feature; MODIFIER	silent_mutation	Average:65.78; most accessible tissue: Callus, score: 90.521	N	N	N	N
vg0203357479	C -> T	LOC_Os02g06670.1	downstream_gene_variant ; 2657.0bp to feature; MODIFIER	silent_mutation	Average:65.78; most accessible tissue: Callus, score: 90.521	N	N	N	N
vg0203357479	C -> T	LOC_Os02g06700.1	downstream_gene_variant ; 1425.0bp to feature; MODIFIER	silent_mutation	Average:65.78; most accessible tissue: Callus, score: 90.521	N	N	N	N
vg0203357479	C -> T	LOC_Os02g06720.1	downstream_gene_variant ; 4568.0bp to feature; MODIFIER	silent_mutation	Average:65.78; most accessible tissue: Callus, score: 90.521	N	N	N	N
vg0203357479	C -> T	LOC_Os02g06700.2	downstream_gene_variant ; 1424.0bp to feature; MODIFIER	silent_mutation	Average:65.78; most accessible tissue: Callus, score: 90.521	N	N	N	N
vg0203357479	C -> T	LOC_Os02g06690.1	intron_variant ; MODIFIER	silent_mutation	Average:65.78; most accessible tissue: Callus, score: 90.521	N	N	N	N
vg0203357479	C -> DEL	N	N	silent_mutation	Average:65.78; most accessible tissue: Callus, score: 90.521	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0203357479	NA	5.02E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	NA	4.72E-06	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	NA	8.53E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	7.76E-06	NA	mr1175_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	NA	1.90E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	NA	6.89E-06	mr1267_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	NA	9.38E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	1.20E-06	7.55E-08	mr1648_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	3.30E-06	9.85E-09	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	3.31E-06	3.31E-06	mr1655_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	2.16E-06	6.02E-06	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	2.09E-06	2.09E-06	mr1669_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479	NA	2.83E-06	mr1861_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251