\
| Variant ID: vg0203357479 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 3357479 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 96. )
TTTATTGTCCCACATGTCGGTGTCTATAATAATAATGTCATTATGATAGAGAATATGAACTCATAAGGACAGACCCAGCCCTCGGCCCCTAGGTCATGGC[C/T]
CGGAGGCCTATGGCTGAACACCCATGTACCTTTTTTTTTTTTGCACCATGATGATAAAAAATTCAGTACACGTGCAACATTACAGTCACACTTTTGAGTC
GACTCAAAAGTGTGACTGTAATGTTGCACGTGTACTGAATTTTTTATCATCATGGTGCAAAAAAAAAAAAGGTACATGGGTGTTCAGCCATAGGCCTCCG[G/A]
GCCATGACCTAGGGGCCGAGGGCTGGGTCTGTCCTTATGAGTTCATATTCTCTATCATAATGACATTATTATTATAGACACCGACATGTGGGACAATAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.50% | 0.60% | 0.11% | 71.79% | NA |
| All Indica | 2759 | 5.80% | 0.30% | 0.07% | 93.80% | NA |
| All Japonica | 1512 | 58.70% | 0.10% | 0.07% | 41.14% | NA |
| Aus | 269 | 78.80% | 6.30% | 0.37% | 14.50% | NA |
| Indica I | 595 | 5.90% | 0.00% | 0.34% | 93.78% | NA |
| Indica II | 465 | 1.90% | 0.00% | 0.00% | 98.06% | NA |
| Indica III | 913 | 6.90% | 0.70% | 0.00% | 92.44% | NA |
| Indica Intermediate | 786 | 6.90% | 0.30% | 0.00% | 92.88% | NA |
| Temperate Japonica | 767 | 67.30% | 0.00% | 0.13% | 32.59% | NA |
| Tropical Japonica | 504 | 52.60% | 0.00% | 0.00% | 47.42% | NA |
| Japonica Intermediate | 241 | 44.40% | 0.40% | 0.00% | 55.19% | NA |
| VI/Aromatic | 96 | 4.20% | 0.00% | 1.04% | 94.79% | NA |
| Intermediate | 90 | 38.90% | 2.20% | 0.00% | 58.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0203357479 | C -> T | LOC_Os02g06660.1 | downstream_gene_variant ; 4869.0bp to feature; MODIFIER | silent_mutation | Average:65.78; most accessible tissue: Callus, score: 90.521 | N | N | N | N |
| vg0203357479 | C -> T | LOC_Os02g06670.1 | downstream_gene_variant ; 2657.0bp to feature; MODIFIER | silent_mutation | Average:65.78; most accessible tissue: Callus, score: 90.521 | N | N | N | N |
| vg0203357479 | C -> T | LOC_Os02g06700.1 | downstream_gene_variant ; 1425.0bp to feature; MODIFIER | silent_mutation | Average:65.78; most accessible tissue: Callus, score: 90.521 | N | N | N | N |
| vg0203357479 | C -> T | LOC_Os02g06720.1 | downstream_gene_variant ; 4568.0bp to feature; MODIFIER | silent_mutation | Average:65.78; most accessible tissue: Callus, score: 90.521 | N | N | N | N |
| vg0203357479 | C -> T | LOC_Os02g06700.2 | downstream_gene_variant ; 1424.0bp to feature; MODIFIER | silent_mutation | Average:65.78; most accessible tissue: Callus, score: 90.521 | N | N | N | N |
| vg0203357479 | C -> T | LOC_Os02g06690.1 | intron_variant ; MODIFIER | silent_mutation | Average:65.78; most accessible tissue: Callus, score: 90.521 | N | N | N | N |
| vg0203357479 | C -> DEL | N | N | silent_mutation | Average:65.78; most accessible tissue: Callus, score: 90.521 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0203357479 | NA | 5.02E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | NA | 4.72E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | NA | 8.53E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | 7.76E-06 | NA | mr1175_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | NA | 1.90E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | NA | 6.89E-06 | mr1267_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | NA | 9.38E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | 1.20E-06 | 7.55E-08 | mr1648_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | 3.30E-06 | 9.85E-09 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | 3.31E-06 | 3.31E-06 | mr1655_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | 2.16E-06 | 6.02E-06 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | 2.09E-06 | 2.09E-06 | mr1669_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203357479 | NA | 2.83E-06 | mr1861_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |