\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203357479:

Variant ID: vg0203357479 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3357479
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATTGTCCCACATGTCGGTGTCTATAATAATAATGTCATTATGATAGAGAATATGAACTCATAAGGACAGACCCAGCCCTCGGCCCCTAGGTCATGGC[C/T]
CGGAGGCCTATGGCTGAACACCCATGTACCTTTTTTTTTTTTGCACCATGATGATAAAAAATTCAGTACACGTGCAACATTACAGTCACACTTTTGAGTC

Reverse complement sequence

GACTCAAAAGTGTGACTGTAATGTTGCACGTGTACTGAATTTTTTATCATCATGGTGCAAAAAAAAAAAAGGTACATGGGTGTTCAGCCATAGGCCTCCG[G/A]
GCCATGACCTAGGGGCCGAGGGCTGGGTCTGTCCTTATGAGTTCATATTCTCTATCATAATGACATTATTATTATAGACACCGACATGTGGGACAATAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.50% 0.60% 0.11% 71.79% NA
All Indica  2759 5.80% 0.30% 0.07% 93.80% NA
All Japonica  1512 58.70% 0.10% 0.07% 41.14% NA
Aus  269 78.80% 6.30% 0.37% 14.50% NA
Indica I  595 5.90% 0.00% 0.34% 93.78% NA
Indica II  465 1.90% 0.00% 0.00% 98.06% NA
Indica III  913 6.90% 0.70% 0.00% 92.44% NA
Indica Intermediate  786 6.90% 0.30% 0.00% 92.88% NA
Temperate Japonica  767 67.30% 0.00% 0.13% 32.59% NA
Tropical Japonica  504 52.60% 0.00% 0.00% 47.42% NA
Japonica Intermediate  241 44.40% 0.40% 0.00% 55.19% NA
VI/Aromatic  96 4.20% 0.00% 1.04% 94.79% NA
Intermediate  90 38.90% 2.20% 0.00% 58.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203357479 C -> T LOC_Os02g06660.1 downstream_gene_variant ; 4869.0bp to feature; MODIFIER silent_mutation Average:65.78; most accessible tissue: Callus, score: 90.521 N N N N
vg0203357479 C -> T LOC_Os02g06670.1 downstream_gene_variant ; 2657.0bp to feature; MODIFIER silent_mutation Average:65.78; most accessible tissue: Callus, score: 90.521 N N N N
vg0203357479 C -> T LOC_Os02g06700.1 downstream_gene_variant ; 1425.0bp to feature; MODIFIER silent_mutation Average:65.78; most accessible tissue: Callus, score: 90.521 N N N N
vg0203357479 C -> T LOC_Os02g06720.1 downstream_gene_variant ; 4568.0bp to feature; MODIFIER silent_mutation Average:65.78; most accessible tissue: Callus, score: 90.521 N N N N
vg0203357479 C -> T LOC_Os02g06700.2 downstream_gene_variant ; 1424.0bp to feature; MODIFIER silent_mutation Average:65.78; most accessible tissue: Callus, score: 90.521 N N N N
vg0203357479 C -> T LOC_Os02g06690.1 intron_variant ; MODIFIER silent_mutation Average:65.78; most accessible tissue: Callus, score: 90.521 N N N N
vg0203357479 C -> DEL N N silent_mutation Average:65.78; most accessible tissue: Callus, score: 90.521 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203357479 NA 5.02E-06 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 NA 4.72E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 NA 8.53E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 7.76E-06 NA mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 NA 1.90E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 NA 6.89E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 NA 9.38E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 1.20E-06 7.55E-08 mr1648_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 3.30E-06 9.85E-09 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 3.31E-06 3.31E-06 mr1655_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 2.16E-06 6.02E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 2.09E-06 2.09E-06 mr1669_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203357479 NA 2.83E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251