Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203293759:

Variant ID: vg0203293759 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3293759
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTACATGCAGCCTACTTACCCATTTGCCAAAAAAAAAAAAAGCTCCTAAAGTTTCCATTATCGCTGTAAATACAATATGTTTGCACCGCCAAAGATA[A/G]
CATTGCACTTATAAATGAGCCTTTTGAAAAAATGGAATGCTCGTTGCATTCTATTTAACTGATACAAGAATTCGACTGCAACTATAGCAAGTTTACTTAT

Reverse complement sequence

ATAAGTAAACTTGCTATAGTTGCAGTCGAATTCTTGTATCAGTTAAATAGAATGCAACGAGCATTCCATTTTTTCAAAAGGCTCATTTATAAGTGCAATG[T/C]
TATCTTTGGCGGTGCAAACATATTGTATTTACAGCGATAATGGAAACTTTAGGAGCTTTTTTTTTTTTTGGCAAATGGGTAAGTAGGCTGCATGTAAATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.70%	28.20%	3.09%	0.00%	NA
All Indica	2759	85.20%	11.40%	3.41%	0.00%	NA
All Japonica	1512	49.70%	47.00%	3.31%	0.00%	NA
Aus	269	12.30%	87.70%	0.00%	0.00%	NA
Indica I	595	84.70%	6.20%	9.08%	0.00%	NA
Indica II	465	93.80%	3.90%	2.37%	0.00%	NA
Indica III	913	83.90%	15.80%	0.33%	0.00%	NA
Indica Intermediate	786	81.90%	14.80%	3.31%	0.00%	NA
Temperate Japonica	767	36.20%	59.30%	4.43%	0.00%	NA
Tropical Japonica	504	75.40%	22.80%	1.79%	0.00%	NA
Japonica Intermediate	241	38.60%	58.50%	2.90%	0.00%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	68.90%	28.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203293759	A -> G	LOC_Os02g06584.2	upstream_gene_variant ; 3451.0bp to feature; MODIFIER	silent_mutation	Average:35.101; most accessible tissue: Callus, score: 79.89	N	N	N	N
vg0203293759	A -> G	LOC_Os02g06584.3	upstream_gene_variant ; 3451.0bp to feature; MODIFIER	silent_mutation	Average:35.101; most accessible tissue: Callus, score: 79.89	N	N	N	N
vg0203293759	A -> G	LOC_Os02g06584.4	upstream_gene_variant ; 3471.0bp to feature; MODIFIER	silent_mutation	Average:35.101; most accessible tissue: Callus, score: 79.89	N	N	N	N
vg0203293759	A -> G	LOC_Os02g06580.1	intron_variant ; MODIFIER	silent_mutation	Average:35.101; most accessible tissue: Callus, score: 79.89	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0203293759	NA	3.49E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203293759	NA	1.92E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203293759	NA	9.27E-06	mr1371	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203293759	NA	3.50E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203293759	NA	4.25E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203293759	NA	1.14E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203293759	NA	1.74E-07	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203293759	3.50E-06	3.50E-06	mr1460_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251