\
| Variant ID: vg0203269607 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 3269607 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CTCTCACTCGATTTTCTCACTCAAATTTACAGTGCATTTTCTTGTAAGTTATAGTGTAATTTATGAAACTTACAATGTAACTTTTATAAGTTACACTGTA[A/G]
TTTTTGAATCTTCGCATGTAAATTTTAAATTTTGTATTGGATTTGGTCTTTTTCTTGAGGATATGGTAATTTAGTGTCCATTATAGTGTTTCTTAATTGC
GCAATTAAGAAACACTATAATGGACACTAAATTACCATATCCTCAAGAAAAAGACCAAATCCAATACAAAATTTAAAATTTACATGCGAAGATTCAAAAA[T/C]
TACAGTGTAACTTATAAAAGTTACATTGTAAGTTTCATAAATTACACTATAACTTACAAGAAAATGCACTGTAAATTTGAGTGAGAAAATCGAGTGAGAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.50% | 13.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 86.70% | 13.20% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 14.50% | 85.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.70% | 13.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.90% | 16.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 82.60% | 17.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0203269607 | A -> G | LOC_Os02g06530.1 | downstream_gene_variant ; 4001.0bp to feature; MODIFIER | silent_mutation | Average:43.94; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg0203269607 | A -> G | LOC_Os02g06540.1 | downstream_gene_variant ; 840.0bp to feature; MODIFIER | silent_mutation | Average:43.94; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg0203269607 | A -> G | LOC_Os02g06550.1 | downstream_gene_variant ; 996.0bp to feature; MODIFIER | silent_mutation | Average:43.94; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| vg0203269607 | A -> G | LOC_Os02g06540-LOC_Os02g06550 | intergenic_region ; MODIFIER | silent_mutation | Average:43.94; most accessible tissue: Zhenshan97 flag leaf, score: 61.322 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0203269607 | 2.07E-06 | NA | mr1004 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203269607 | 1.29E-06 | NA | mr1150 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |