Variant ID: vg0203127408 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 3127408 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 345. )
GAGTTGTCAAATGTATCAAACTGGCCTCCAGTTGGAATAGGTCCTTCCAGGTCATTGTTAGAAACATTGAAGGCAGAAAGGAAGTGCAGCTTGTTCAGTT[C/T]
CAAAGGGATTGCACCCATTAGATTGTTGCTAGACAAGTCTAGCATCTCCAGGTTGGTGAGGTTGCAAATTGCTTGTGGGATCTCTCCAGAGAAGCTATTG
CAATAGCTTCTCTGGAGAGATCCCACAAGCAATTTGCAACCTCACCAACCTGGAGATGCTAGACTTGTCTAGCAACAATCTAATGGGTGCAATCCCTTTG[G/A]
AACTGAACAAGCTGCACTTCCTTTCTGCCTTCAATGTTTCTAACAATGACCTGGAAGGACCTATTCCAACTGGAGGCCAGTTTGATACATTTGACAACTC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.70% | 3.40% | 1.59% | 0.32% | NA |
All Indica | 2759 | 99.00% | 0.00% | 0.47% | 0.54% | NA |
All Japonica | 1512 | 85.40% | 10.60% | 4.03% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.00% | 0.00% | 1.01% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
Indica III | 913 | 98.40% | 0.00% | 0.00% | 1.64% | NA |
Indica Intermediate | 786 | 99.20% | 0.00% | 0.76% | 0.00% | NA |
Temperate Japonica | 767 | 77.60% | 15.90% | 6.52% | 0.00% | NA |
Tropical Japonica | 504 | 98.80% | 0.20% | 0.99% | 0.00% | NA |
Japonica Intermediate | 241 | 82.20% | 15.40% | 2.49% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0203127408 | C -> T | LOC_Os02g06260.1 | missense_variant ; p.Glu617Lys; MODERATE | nonsynonymous_codon ; E617K | Average:48.153; most accessible tissue: Zhenshan97 young leaf, score: 59.009 | benign | 1.078 | DELETERIOUS | 0.01 |
vg0203127408 | C -> DEL | LOC_Os02g06260.1 | N | frameshift_variant | Average:48.153; most accessible tissue: Zhenshan97 young leaf, score: 59.009 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0203127408 | 3.16E-06 | 3.16E-06 | mr1008 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203127408 | 8.90E-06 | 8.90E-06 | mr1009 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203127408 | NA | 2.57E-06 | mr1210 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0203127408 | NA | 6.61E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |