\
| Variant ID: vg0203032931 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 3032931 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACTACAGTAAACATTTGTTAATGACAGATTAATTAGGCTTAATAGATTCGTCTCGCAATTTACAGACGGAATATGTAATTTGTTTTGTTATTAGTCTAC[G/A]
TTTAATACTTCAAATGTGTGTCCGTATACGTAAAAAAAAATTTGGACACGAACTTTTTTTTTGAGGGAATGCCATTTGTCAAGCTTTATTGATCATTAAA
TTTAATGATCAATAAAGCTTGACAAATGGCATTCCCTCAAAAAAAAAGTTCGTGTCCAAATTTTTTTTTACGTATACGGACACACATTTGAAGTATTAAA[C/T]
GTAGACTAATAACAAAACAAATTACATATTCCGTCTGTAAATTGCGAGACGAATCTATTAAGCCTAATTAATCTGTCATTAACAAATGTTTACTGTAGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.20% | 3.10% | 2.03% | 28.65% | NA |
| All Indica | 2759 | 57.70% | 0.30% | 1.63% | 40.38% | NA |
| All Japonica | 1512 | 87.80% | 8.70% | 3.04% | 0.53% | NA |
| Aus | 269 | 18.60% | 0.70% | 0.37% | 80.30% | NA |
| Indica I | 595 | 70.10% | 0.00% | 1.01% | 28.91% | NA |
| Indica II | 465 | 67.50% | 0.40% | 2.58% | 29.46% | NA |
| Indica III | 913 | 42.60% | 0.40% | 1.86% | 55.09% | NA |
| Indica Intermediate | 786 | 60.20% | 0.10% | 1.27% | 38.42% | NA |
| Temperate Japonica | 767 | 97.80% | 0.00% | 1.96% | 0.26% | NA |
| Tropical Japonica | 504 | 68.70% | 25.20% | 4.96% | 1.19% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.70% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 74.40% | 6.70% | 4.44% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0203032931 | G -> A | LOC_Os02g06070.1 | upstream_gene_variant ; 1818.0bp to feature; MODIFIER | silent_mutation | Average:19.742; most accessible tissue: Callus, score: 66.803 | N | N | N | N |
| vg0203032931 | G -> A | LOC_Os02g06090.1 | upstream_gene_variant ; 4294.0bp to feature; MODIFIER | silent_mutation | Average:19.742; most accessible tissue: Callus, score: 66.803 | N | N | N | N |
| vg0203032931 | G -> A | LOC_Os02g06080.1 | downstream_gene_variant ; 1108.0bp to feature; MODIFIER | silent_mutation | Average:19.742; most accessible tissue: Callus, score: 66.803 | N | N | N | N |
| vg0203032931 | G -> A | LOC_Os02g06070-LOC_Os02g06080 | intergenic_region ; MODIFIER | silent_mutation | Average:19.742; most accessible tissue: Callus, score: 66.803 | N | N | N | N |
| vg0203032931 | G -> DEL | N | N | silent_mutation | Average:19.742; most accessible tissue: Callus, score: 66.803 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0203032931 | 2.99E-07 | 3.77E-07 | mr1188 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203032931 | NA | 8.41E-08 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203032931 | NA | 7.97E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203032931 | NA | 2.88E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0203032931 | NA | 8.20E-07 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |