Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203032931:

Variant ID: vg0203032931 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 3032931
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACTACAGTAAACATTTGTTAATGACAGATTAATTAGGCTTAATAGATTCGTCTCGCAATTTACAGACGGAATATGTAATTTGTTTTGTTATTAGTCTAC[G/A]
TTTAATACTTCAAATGTGTGTCCGTATACGTAAAAAAAAATTTGGACACGAACTTTTTTTTTGAGGGAATGCCATTTGTCAAGCTTTATTGATCATTAAA

Reverse complement sequence

TTTAATGATCAATAAAGCTTGACAAATGGCATTCCCTCAAAAAAAAAGTTCGTGTCCAAATTTTTTTTTACGTATACGGACACACATTTGAAGTATTAAA[C/T]
GTAGACTAATAACAAAACAAATTACATATTCCGTCTGTAAATTGCGAGACGAATCTATTAAGCCTAATTAATCTGTCATTAACAAATGTTTACTGTAGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.20%	3.10%	2.03%	28.65%	NA
All Indica	2759	57.70%	0.30%	1.63%	40.38%	NA
All Japonica	1512	87.80%	8.70%	3.04%	0.53%	NA
Aus	269	18.60%	0.70%	0.37%	80.30%	NA
Indica I	595	70.10%	0.00%	1.01%	28.91%	NA
Indica II	465	67.50%	0.40%	2.58%	29.46%	NA
Indica III	913	42.60%	0.40%	1.86%	55.09%	NA
Indica Intermediate	786	60.20%	0.10%	1.27%	38.42%	NA
Temperate Japonica	767	97.80%	0.00%	1.96%	0.26%	NA
Tropical Japonica	504	68.70%	25.20%	4.96%	1.19%	NA
Japonica Intermediate	241	95.90%	1.70%	2.49%	0.00%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	74.40%	6.70%	4.44%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0203032931	G -> A	LOC_Os02g06070.1	upstream_gene_variant ; 1818.0bp to feature; MODIFIER	silent_mutation	Average:19.742; most accessible tissue: Callus, score: 66.803	N	N	N	N
vg0203032931	G -> A	LOC_Os02g06090.1	upstream_gene_variant ; 4294.0bp to feature; MODIFIER	silent_mutation	Average:19.742; most accessible tissue: Callus, score: 66.803	N	N	N	N
vg0203032931	G -> A	LOC_Os02g06080.1	downstream_gene_variant ; 1108.0bp to feature; MODIFIER	silent_mutation	Average:19.742; most accessible tissue: Callus, score: 66.803	N	N	N	N
vg0203032931	G -> A	LOC_Os02g06070-LOC_Os02g06080	intergenic_region ; MODIFIER	silent_mutation	Average:19.742; most accessible tissue: Callus, score: 66.803	N	N	N	N
vg0203032931	G -> DEL	N	N	silent_mutation	Average:19.742; most accessible tissue: Callus, score: 66.803	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0203032931	2.99E-07	3.77E-07	mr1188	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203032931	NA	8.41E-08	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203032931	NA	7.97E-07	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203032931	NA	2.88E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203032931	NA	8.20E-07	mr1798_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251