\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0203032931:

Variant ID: vg0203032931 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 3032931
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTACAGTAAACATTTGTTAATGACAGATTAATTAGGCTTAATAGATTCGTCTCGCAATTTACAGACGGAATATGTAATTTGTTTTGTTATTAGTCTAC[G/A]
TTTAATACTTCAAATGTGTGTCCGTATACGTAAAAAAAAATTTGGACACGAACTTTTTTTTTGAGGGAATGCCATTTGTCAAGCTTTATTGATCATTAAA

Reverse complement sequence

TTTAATGATCAATAAAGCTTGACAAATGGCATTCCCTCAAAAAAAAAGTTCGTGTCCAAATTTTTTTTTACGTATACGGACACACATTTGAAGTATTAAA[C/T]
GTAGACTAATAACAAAACAAATTACATATTCCGTCTGTAAATTGCGAGACGAATCTATTAAGCCTAATTAATCTGTCATTAACAAATGTTTACTGTAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 3.10% 2.03% 28.65% NA
All Indica  2759 57.70% 0.30% 1.63% 40.38% NA
All Japonica  1512 87.80% 8.70% 3.04% 0.53% NA
Aus  269 18.60% 0.70% 0.37% 80.30% NA
Indica I  595 70.10% 0.00% 1.01% 28.91% NA
Indica II  465 67.50% 0.40% 2.58% 29.46% NA
Indica III  913 42.60% 0.40% 1.86% 55.09% NA
Indica Intermediate  786 60.20% 0.10% 1.27% 38.42% NA
Temperate Japonica  767 97.80% 0.00% 1.96% 0.26% NA
Tropical Japonica  504 68.70% 25.20% 4.96% 1.19% NA
Japonica Intermediate  241 95.90% 1.70% 2.49% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 74.40% 6.70% 4.44% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0203032931 G -> A LOC_Os02g06070.1 upstream_gene_variant ; 1818.0bp to feature; MODIFIER silent_mutation Average:19.742; most accessible tissue: Callus, score: 66.803 N N N N
vg0203032931 G -> A LOC_Os02g06090.1 upstream_gene_variant ; 4294.0bp to feature; MODIFIER silent_mutation Average:19.742; most accessible tissue: Callus, score: 66.803 N N N N
vg0203032931 G -> A LOC_Os02g06080.1 downstream_gene_variant ; 1108.0bp to feature; MODIFIER silent_mutation Average:19.742; most accessible tissue: Callus, score: 66.803 N N N N
vg0203032931 G -> A LOC_Os02g06070-LOC_Os02g06080 intergenic_region ; MODIFIER silent_mutation Average:19.742; most accessible tissue: Callus, score: 66.803 N N N N
vg0203032931 G -> DEL N N silent_mutation Average:19.742; most accessible tissue: Callus, score: 66.803 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0203032931 2.99E-07 3.77E-07 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203032931 NA 8.41E-08 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203032931 NA 7.97E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203032931 NA 2.88E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0203032931 NA 8.20E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251