\
| Variant ID: vg0202989689 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2989689 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )
TGTCGTCTGCACGACAGGTGAGCACTCGGAGAATCGAGCGCATCGACTCCACCATCCGCGTGTACGTCGTCAGGTGCTCCTCTACGGGTACCGGAATCCC[T/C]
GCGTCTAAACGTTGGATCGTCGTTGAACCGTCAACGACGACCCGGTTGATGTCGTCGACCTGCATGGTTAATTTGTTCATACATATTCGTAACATTTGAC
GTCAAATGTTACGAATATGTATGAACAAATTAACCATGCAGGTCGACGACATCAACCGGGTCGTCGTTGACGGTTCAACGACGATCCAACGTTTAGACGC[A/G]
GGGATTCCGGTACCCGTAGAGGAGCACCTGACGACGTACACGCGGATGGTGGAGTCGATGCGCTCGATTCTCCGAGTGCTCACCTGTCGTGCAGACGACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.80% | 20.30% | 0.80% | 0.11% | NA |
| All Indica | 2759 | 97.40% | 2.40% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 39.90% | 57.90% | 1.92% | 0.33% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 3.40% | 0.84% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 97.20% | 2.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 15.50% | 83.10% | 1.30% | 0.13% | NA |
| Tropical Japonica | 504 | 83.70% | 12.30% | 3.17% | 0.79% | NA |
| Japonica Intermediate | 241 | 25.70% | 73.00% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 21.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202989689 | T -> DEL | LOC_Os02g05990.1 | N | frameshift_variant | Average:28.043; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| vg0202989689 | T -> C | LOC_Os02g05990.1 | synonymous_variant ; p.Ala432Ala; LOW | synonymous_codon | Average:28.043; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202989689 | NA | 1.53E-06 | mr1029 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 9.63E-06 | mr1725 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 1.18E-07 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 5.78E-09 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 7.10E-12 | mr1368_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 7.86E-07 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 1.81E-08 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 2.81E-10 | mr1584_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 1.37E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 4.33E-06 | mr1633_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 5.53E-06 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | NA | 2.16E-17 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | 3.65E-06 | 2.25E-07 | mr1683_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202989689 | 7.83E-06 | 3.10E-06 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |