\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0202925463:

Variant ID: vg0202925463 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 2925463
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGAACTTGTCATAGTGTGTCATCTAGGTCTCAAATCACCACAGCCCCTTCAAAATCCTACGTGGTGCTGATGTGGCATGCCACACGAACATTTAAAAA[T/A]
TTTCACTTTCTTTTTTTTTCTCTTTTTCTTCTCCTTCTTTTATTTTTTTCCTTTCTTCTCCTTTCTTCGTGACCCGAGCAAAAGAAAGGGAAAAAAGAAG

Reverse complement sequence

CTTCTTTTTTCCCTTTCTTTTGCTCGGGTCACGAAGAAAGGAGAAGAAAGGAAAAAAATAAAAGAAGGAGAAGAAAAAGAGAAAAAAAAAGAAAGTGAAA[A/T]
TTTTTAAATGTTCGTGTGGCATGCCACATCAGCACCACGTAGGATTTTGAAGGGGCTGTGGTGATTTGAGACCTAGATGACACACTATGACAAGTTCTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 2.50% 2.20% 1.14% NA
All Indica  2759 90.50% 4.30% 3.23% 1.96% NA
All Japonica  1512 99.20% 0.00% 0.79% 0.00% NA
Aus  269 98.90% 0.00% 1.12% 0.00% NA
Indica I  595 79.80% 10.90% 9.24% 0.00% NA
Indica II  465 94.60% 2.40% 2.58% 0.43% NA
Indica III  913 96.20% 0.00% 0.11% 3.72% NA
Indica Intermediate  786 89.40% 5.60% 2.67% 2.29% NA
Temperate Japonica  767 98.70% 0.00% 1.30% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0202925463 T -> A LOC_Os02g05890.1 upstream_gene_variant ; 390.0bp to feature; MODIFIER silent_mutation Average:71.161; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0202925463 T -> A LOC_Os02g05900.1 upstream_gene_variant ; 3459.0bp to feature; MODIFIER silent_mutation Average:71.161; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0202925463 T -> A LOC_Os02g05890-LOC_Os02g05900 intergenic_region ; MODIFIER silent_mutation Average:71.161; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N
vg0202925463 T -> DEL N N silent_mutation Average:71.161; most accessible tissue: Zhenshan97 root, score: 79.452 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0202925463 9.29E-12 7.80E-17 mr1038 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202925463 7.22E-10 4.29E-15 mr1038 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202925463 1.14E-11 1.98E-18 mr1389 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202925463 2.12E-09 2.68E-15 mr1389 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202925463 1.85E-07 3.73E-14 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202925463 2.83E-07 1.34E-12 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202925463 3.90E-06 1.00E-11 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0202925463 7.90E-06 5.89E-11 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251