\
| Variant ID: vg0202925463 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 2925463 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 100. )
GCAGAACTTGTCATAGTGTGTCATCTAGGTCTCAAATCACCACAGCCCCTTCAAAATCCTACGTGGTGCTGATGTGGCATGCCACACGAACATTTAAAAA[T/A]
TTTCACTTTCTTTTTTTTTCTCTTTTTCTTCTCCTTCTTTTATTTTTTTCCTTTCTTCTCCTTTCTTCGTGACCCGAGCAAAAGAAAGGGAAAAAAGAAG
CTTCTTTTTTCCCTTTCTTTTGCTCGGGTCACGAAGAAAGGAGAAGAAAGGAAAAAAATAAAAGAAGGAGAAGAAAAAGAGAAAAAAAAAGAAAGTGAAA[A/T]
TTTTTAAATGTTCGTGTGGCATGCCACATCAGCACCACGTAGGATTTTGAAGGGGCTGTGGTGATTTGAGACCTAGATGACACACTATGACAAGTTCTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 2.50% | 2.20% | 1.14% | NA |
| All Indica | 2759 | 90.50% | 4.30% | 3.23% | 1.96% | NA |
| All Japonica | 1512 | 99.20% | 0.00% | 0.79% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.00% | 1.12% | 0.00% | NA |
| Indica I | 595 | 79.80% | 10.90% | 9.24% | 0.00% | NA |
| Indica II | 465 | 94.60% | 2.40% | 2.58% | 0.43% | NA |
| Indica III | 913 | 96.20% | 0.00% | 0.11% | 3.72% | NA |
| Indica Intermediate | 786 | 89.40% | 5.60% | 2.67% | 2.29% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0202925463 | T -> A | LOC_Os02g05890.1 | upstream_gene_variant ; 390.0bp to feature; MODIFIER | silent_mutation | Average:71.161; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0202925463 | T -> A | LOC_Os02g05900.1 | upstream_gene_variant ; 3459.0bp to feature; MODIFIER | silent_mutation | Average:71.161; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0202925463 | T -> A | LOC_Os02g05890-LOC_Os02g05900 | intergenic_region ; MODIFIER | silent_mutation | Average:71.161; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| vg0202925463 | T -> DEL | N | N | silent_mutation | Average:71.161; most accessible tissue: Zhenshan97 root, score: 79.452 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0202925463 | 9.29E-12 | 7.80E-17 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202925463 | 7.22E-10 | 4.29E-15 | mr1038 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202925463 | 1.14E-11 | 1.98E-18 | mr1389 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202925463 | 2.12E-09 | 2.68E-15 | mr1389 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202925463 | 1.85E-07 | 3.73E-14 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202925463 | 2.83E-07 | 1.34E-12 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202925463 | 3.90E-06 | 1.00E-11 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0202925463 | 7.90E-06 | 5.89E-11 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |